Multiple sequence alignment - TraesCS1D01G050600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G050600 chr1D 100.000 2862 0 0 1 2862 30776829 30779690 0.000000e+00 5286
1 TraesCS1D01G050600 chr1D 98.116 2654 41 2 218 2862 30704224 30706877 0.000000e+00 4615
2 TraesCS1D01G050600 chr1D 99.301 2147 14 1 717 2862 30880886 30883032 0.000000e+00 3880
3 TraesCS1D01G050600 chr1D 99.022 2147 20 1 717 2862 30821946 30824092 0.000000e+00 3847
4 TraesCS1D01G050600 chr1D 97.974 1826 36 1 1037 2862 30934140 30935964 0.000000e+00 3166
5 TraesCS1D01G050600 chr1D 98.434 1405 21 1 1458 2862 30848829 30850232 0.000000e+00 2471
6 TraesCS1D01G050600 chr1D 98.363 1405 22 1 1458 2862 30723645 30725048 0.000000e+00 2466
7 TraesCS1D01G050600 chr1D 96.541 665 15 1 1 657 30821282 30821946 0.000000e+00 1094
8 TraesCS1D01G050600 chr1D 96.541 665 15 1 1 657 30925539 30926203 0.000000e+00 1094
9 TraesCS1D01G050600 chr1D 96.391 665 16 1 1 657 30880222 30880886 0.000000e+00 1088
10 TraesCS1D01G050600 chr1D 98.886 359 3 1 1103 1460 30709598 30709956 8.650000e-180 640
11 TraesCS1D01G050600 chr1D 98.324 358 5 1 1103 1460 30834754 30835110 6.730000e-176 627
12 TraesCS1D01G050600 chr1D 99.388 327 2 0 717 1043 30926203 30926529 6.830000e-166 593
13 TraesCS1D01G050600 chr1D 97.273 220 6 0 1 220 30703376 30703595 9.680000e-100 374
14 TraesCS1D01G050600 chr5A 89.655 174 17 1 2689 2862 538845254 538845426 1.330000e-53 220
15 TraesCS1D01G050600 chr7D 83.028 218 28 7 2654 2862 106355386 106355169 3.760000e-44 189
16 TraesCS1D01G050600 chr6B 87.821 156 19 0 2707 2862 530577766 530577611 1.750000e-42 183


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G050600 chr1D 30776829 30779690 2861 False 5286.000000 5286 100.000000 1 2862 1 chr1D.!!$F2 2861
1 TraesCS1D01G050600 chr1D 30934140 30935964 1824 False 3166.000000 3166 97.974000 1037 2862 1 chr1D.!!$F5 1825
2 TraesCS1D01G050600 chr1D 30880222 30883032 2810 False 2484.000000 3880 97.846000 1 2862 2 chr1D.!!$F8 2861
3 TraesCS1D01G050600 chr1D 30848829 30850232 1403 False 2471.000000 2471 98.434000 1458 2862 1 chr1D.!!$F4 1404
4 TraesCS1D01G050600 chr1D 30821282 30824092 2810 False 2470.500000 3847 97.781500 1 2862 2 chr1D.!!$F7 2861
5 TraesCS1D01G050600 chr1D 30723645 30725048 1403 False 2466.000000 2466 98.363000 1458 2862 1 chr1D.!!$F1 1404
6 TraesCS1D01G050600 chr1D 30703376 30709956 6580 False 1876.333333 4615 98.091667 1 2862 3 chr1D.!!$F6 2861
7 TraesCS1D01G050600 chr1D 30925539 30926529 990 False 843.500000 1094 97.964500 1 1043 2 chr1D.!!$F9 1042

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
340 980 0.390472 GTGGACAGCAGGTAGAGCAC 60.39 60.0 0.0 0.0 0.0 4.4 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2265 2906 5.684184 CCGTGCATGATCAATTTTATGTCAG 59.316 40.0 7.72 0.0 0.0 3.51 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
283 915 2.410322 CTTGGGTAGTGTGGGCAGCA 62.410 60.000 0.00 0.0 0.00 4.41
340 980 0.390472 GTGGACAGCAGGTAGAGCAC 60.390 60.000 0.00 0.0 0.00 4.40
494 1134 8.420222 AGAATGAAACAACATCCACAAATGTTA 58.580 29.630 2.23 0.0 45.68 2.41
581 1221 4.410883 AGACATACCCCATTATTTCCGTCA 59.589 41.667 0.00 0.0 0.00 4.35
601 1241 9.058174 TCCGTCAGAATTAATGAACTGTTAAAA 57.942 29.630 13.44 0.0 0.00 1.52
1080 1720 2.750141 AGACTATCCTCCGCAACCTA 57.250 50.000 0.00 0.0 0.00 3.08
1130 1770 2.310052 AGAAATCCCTTCTTGAGGTGGG 59.690 50.000 0.00 0.0 41.97 4.61
2265 2906 5.059710 GTCAAATATGTTTGCTTCAAGTCGC 59.940 40.000 9.87 0.0 43.47 5.19
2302 2943 0.109532 TGCACGGTTGAAGGGAATGA 59.890 50.000 0.00 0.0 0.00 2.57
2543 3184 9.979578 AACTAAATGTCACATAAGCAAAATTGA 57.020 25.926 0.00 0.0 0.00 2.57
2554 3195 8.306038 ACATAAGCAAAATTGATGAGCTAAACA 58.694 29.630 0.00 0.0 34.66 2.83
2723 3364 2.158813 GGTCCGTGTGTTATCATGGGAT 60.159 50.000 5.31 0.0 42.77 3.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
240 872 2.347490 CCAACAGCACGCCTAGGT 59.653 61.111 11.31 0.0 0.00 3.08
340 980 2.426651 TAGCCCACGCTAAGCCTAG 58.573 57.895 0.00 0.0 46.08 3.02
494 1134 4.473444 AGTCTTTTTGGTGTGGTGATGAT 58.527 39.130 0.00 0.0 0.00 2.45
705 1345 1.129917 CTGGATCACTGATGCTCCCT 58.870 55.000 11.42 0.0 39.96 4.20
715 1355 6.541641 GCATCTCTTAACAAATCTGGATCACT 59.458 38.462 0.00 0.0 0.00 3.41
1130 1770 2.058057 CAACGTAATGCCCAAACTTGC 58.942 47.619 0.00 0.0 0.00 4.01
2265 2906 5.684184 CCGTGCATGATCAATTTTATGTCAG 59.316 40.000 7.72 0.0 0.00 3.51
2543 3184 9.534565 CACAGTATAACATAGTGTTTAGCTCAT 57.465 33.333 0.20 0.0 41.45 2.90
2554 3195 7.549488 GGAGAAACTTGCACAGTATAACATAGT 59.451 37.037 0.00 0.0 32.94 2.12
2723 3364 7.725251 TGATAGCATCACATACATGAGTGTTA 58.275 34.615 0.00 0.0 35.61 2.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.