AutoCloner

Multiple sequence alignment - TraesCS1D01G050600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)

BLAST Results

Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

	qseqid	sseqid	percentage.identical	alignment.length	no.mismatch	no.gap.openings	qstart	qend	sstart	send	evalue	bitscore
0	TraesCS1D01G050600	chr1D	100.000	2862	0	0	1	2862	30776829	30779690	0.000000e+00	5286
1	TraesCS1D01G050600	chr1D	98.116	2654	41	2	218	2862	30704224	30706877	0.000000e+00	4615
2	TraesCS1D01G050600	chr1D	99.301	2147	14	1	717	2862	30880886	30883032	0.000000e+00	3880
3	TraesCS1D01G050600	chr1D	99.022	2147	20	1	717	2862	30821946	30824092	0.000000e+00	3847
4	TraesCS1D01G050600	chr1D	97.974	1826	36	1	1037	2862	30934140	30935964	0.000000e+00	3166
5	TraesCS1D01G050600	chr1D	98.434	1405	21	1	1458	2862	30848829	30850232	0.000000e+00	2471
6	TraesCS1D01G050600	chr1D	98.363	1405	22	1	1458	2862	30723645	30725048	0.000000e+00	2466
7	TraesCS1D01G050600	chr1D	96.541	665	15	1	1	657	30821282	30821946	0.000000e+00	1094
8	TraesCS1D01G050600	chr1D	96.541	665	15	1	1	657	30925539	30926203	0.000000e+00	1094
9	TraesCS1D01G050600	chr1D	96.391	665	16	1	1	657	30880222	30880886	0.000000e+00	1088
10	TraesCS1D01G050600	chr1D	98.886	359	3	1	1103	1460	30709598	30709956	8.650000e-180	640
11	TraesCS1D01G050600	chr1D	98.324	358	5	1	1103	1460	30834754	30835110	6.730000e-176	627
12	TraesCS1D01G050600	chr1D	99.388	327	2	0	717	1043	30926203	30926529	6.830000e-166	593
13	TraesCS1D01G050600	chr1D	97.273	220	6	0	1	220	30703376	30703595	9.680000e-100	374
14	TraesCS1D01G050600	chr5A	89.655	174	17	1	2689	2862	538845254	538845426	1.330000e-53	220
15	TraesCS1D01G050600	chr7D	83.028	218	28	7	2654	2862	106355386	106355169	3.760000e-44	189
16	TraesCS1D01G050600	chr6B	87.821	156	19	0	2707	2862	530577766	530577611	1.750000e-42	183

These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

	query	scaffold	start	end	length	rev.comp	avg.bitscore	max.bitscore	avg.percent.identical	query.start	query.end	num_hsp	groupid	homo_length
0	TraesCS1D01G050600	chr1D	30776829	30779690	2861	False	5286.000000	5286	100.000000	1	2862	1	chr1D.!!$F2	2861
1	TraesCS1D01G050600	chr1D	30934140	30935964	1824	False	3166.000000	3166	97.974000	1037	2862	1	chr1D.!!$F5	1825
2	TraesCS1D01G050600	chr1D	30880222	30883032	2810	False	2484.000000	3880	97.846000	1	2862	2	chr1D.!!$F8	2861
3	TraesCS1D01G050600	chr1D	30848829	30850232	1403	False	2471.000000	2471	98.434000	1458	2862	1	chr1D.!!$F4	1404
4	TraesCS1D01G050600	chr1D	30821282	30824092	2810	False	2470.500000	3847	97.781500	1	2862	2	chr1D.!!$F7	2861
5	TraesCS1D01G050600	chr1D	30723645	30725048	1403	False	2466.000000	2466	98.363000	1458	2862	1	chr1D.!!$F1	1404
6	TraesCS1D01G050600	chr1D	30703376	30709956	6580	False	1876.333333	4615	98.091667	1	2862	3	chr1D.!!$F6	2861
7	TraesCS1D01G050600	chr1D	30925539	30926529	990	False	843.500000	1094	97.964500	1	1043	2	chr1D.!!$F9	1042

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
340	980	0.390472	GTGGACAGCAGGTAGAGCAC	60.39	60.0	0.0	0.0	0.0	4.4	F

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
2265	2906	5.684184	CCGTGCATGATCAATTTTATGTCAG	59.316	40.0	7.72	0.0	0.0	3.51	R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Hairpin	End Stability
283	915	2.410322	CTTGGGTAGTGTGGGCAGCA	62.410	60.000	0.00	0.00	4.41
340	980	0.390472	GTGGACAGCAGGTAGAGCAC	60.390	60.000	0.00	0.00	4.40
494	1134	8.420222	AGAATGAAACAACATCCACAAATGTTA	58.580	29.630	2.23	45.68	2.41
581	1221	4.410883	AGACATACCCCATTATTTCCGTCA	59.589	41.667	0.00	0.00	4.35
601	1241	9.058174	TCCGTCAGAATTAATGAACTGTTAAAA	57.942	29.630	13.44	0.00	1.52
1080	1720	2.750141	AGACTATCCTCCGCAACCTA	57.250	50.000	0.00	0.00	3.08
1130	1770	2.310052	AGAAATCCCTTCTTGAGGTGGG	59.690	50.000	0.00	41.97	4.61
2265	2906	5.059710	GTCAAATATGTTTGCTTCAAGTCGC	59.940	40.000	9.87	43.47	5.19
2302	2943	0.109532	TGCACGGTTGAAGGGAATGA	59.890	50.000	0.00	0.00	2.57
2543	3184	9.979578	AACTAAATGTCACATAAGCAAAATTGA	57.020	25.926	0.00	0.00	2.57
2554	3195	8.306038	ACATAAGCAAAATTGATGAGCTAAACA	58.694	29.630	0.00	34.66	2.83
2723	3364	2.158813	GGTCCGTGTGTTATCATGGGAT	60.159	50.000	5.31	42.77	3.85

Showing 1 to 12 of 12 entries

Previous1Next

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Hairpin	End Stability
240	872	2.347490	CCAACAGCACGCCTAGGT	59.653	61.111	11.31	0.00	3.08
340	980	2.426651	TAGCCCACGCTAAGCCTAG	58.573	57.895	0.00	46.08	3.02
494	1134	4.473444	AGTCTTTTTGGTGTGGTGATGAT	58.527	39.130	0.00	0.00	2.45
705	1345	1.129917	CTGGATCACTGATGCTCCCT	58.870	55.000	11.42	39.96	4.20
715	1355	6.541641	GCATCTCTTAACAAATCTGGATCACT	59.458	38.462	0.00	0.00	3.41
1130	1770	2.058057	CAACGTAATGCCCAAACTTGC	58.942	47.619	0.00	0.00	4.01
2265	2906	5.684184	CCGTGCATGATCAATTTTATGTCAG	59.316	40.000	7.72	0.00	3.51
2543	3184	9.534565	CACAGTATAACATAGTGTTTAGCTCAT	57.465	33.333	0.20	41.45	2.90
2554	3195	7.549488	GGAGAAACTTGCACAGTATAACATAGT	59.451	37.037	0.00	32.94	2.12
2723	3364	7.725251	TGATAGCATCACATACATGAGTGTTA	58.275	34.615	0.00	35.61	2.41

Showing 1 to 10 of 10 entries

Previous1Next

Based at the University of Bristol with support from BBSRC.

AutoCloner maintained by Alex Coulton.