Multiple sequence alignment - TraesCS1D01G047000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G047000 chr1D 100.000 1618 0 0 1 1618 26689926 26691543 0.000000e+00 2988.0
1 TraesCS1D01G047000 chr1D 98.161 1577 27 2 1 1576 26675841 26677416 0.000000e+00 2750.0
2 TraesCS1D01G047000 chr1D 100.000 1267 0 0 2260 3526 26692185 26693451 0.000000e+00 2340.0
3 TraesCS1D01G047000 chr1D 98.816 1267 14 1 2260 3526 26677817 26679082 0.000000e+00 2255.0
4 TraesCS1D01G047000 chr1D 93.293 164 11 0 2332 2495 26677814 26677977 3.520000e-60 243.0
5 TraesCS1D01G047000 chr1D 93.789 161 10 0 2335 2495 26692185 26692345 3.520000e-60 243.0
6 TraesCS1D01G047000 chr1D 93.789 161 10 0 2260 2420 26692260 26692420 3.520000e-60 243.0
7 TraesCS1D01G047000 chr1D 79.155 355 68 3 1258 1606 26676936 26677290 1.260000e-59 241.0
8 TraesCS1D01G047000 chr1D 93.168 161 11 0 2260 2420 26677892 26678052 1.640000e-58 237.0
9 TraesCS1D01G047000 chr1D 96.053 76 2 1 1544 1618 26677873 26677948 4.780000e-24 122.0
10 TraesCS1D01G047000 chr1D 97.101 69 2 0 1550 1618 26692248 26692316 2.220000e-22 117.0
11 TraesCS1D01G047000 chr1D 95.652 69 3 0 1550 1618 26692323 26692391 1.030000e-20 111.0
12 TraesCS1D01G047000 chr1D 88.764 89 10 0 2407 2495 26677814 26677902 3.720000e-20 110.0
13 TraesCS1D01G047000 chr1D 89.535 86 9 0 2410 2495 26692185 26692270 3.720000e-20 110.0
14 TraesCS1D01G047000 chr1D 89.535 86 9 0 2260 2345 26692335 26692420 3.720000e-20 110.0
15 TraesCS1D01G047000 chr1D 94.203 69 4 0 1550 1618 26677955 26678023 4.810000e-19 106.0
16 TraesCS1D01G047000 chr1D 88.372 86 10 0 2260 2345 26677967 26678052 1.730000e-18 104.0
17 TraesCS1D01G047000 chr1D 95.000 60 3 0 1559 1618 26677814 26677873 1.040000e-15 95.3
18 TraesCS1D01G047000 chr1D 94.737 57 3 0 2260 2316 26691487 26691543 4.850000e-14 89.8
19 TraesCS1D01G047000 chr1B 93.860 798 45 4 1 798 42324645 42325438 0.000000e+00 1199.0
20 TraesCS1D01G047000 chr1B 87.947 755 60 7 2775 3526 42328124 42328850 0.000000e+00 861.0
21 TraesCS1D01G047000 chr1B 93.256 519 28 4 2260 2772 42326131 42326648 0.000000e+00 758.0
22 TraesCS1D01G047000 chr1B 82.865 712 86 24 929 1618 42325490 42326187 1.080000e-169 606.0
23 TraesCS1D01G047000 chr1B 88.182 440 49 3 1182 1618 42325673 42326112 4.030000e-144 521.0
24 TraesCS1D01G047000 chr1B 92.797 236 17 0 2260 2495 42326056 42326291 3.370000e-90 342.0
25 TraesCS1D01G047000 chr1B 79.110 517 86 17 1107 1618 42325763 42326262 1.570000e-88 337.0
26 TraesCS1D01G047000 chr1B 94.410 161 9 0 2260 2420 42326206 42326366 7.560000e-62 248.0
27 TraesCS1D01G047000 chr1B 87.037 216 26 2 2281 2495 42326002 42326216 3.520000e-60 243.0
28 TraesCS1D01G047000 chr1B 75.915 519 97 23 1105 1618 42325842 42326337 1.260000e-59 241.0
29 TraesCS1D01G047000 chr1B 77.091 275 56 6 1258 1527 42325668 42325940 6.100000e-33 152.0
30 TraesCS1D01G047000 chr1B 83.916 143 21 2 2354 2495 42326000 42326141 6.140000e-28 135.0
31 TraesCS1D01G047000 chr1B 85.088 114 12 3 2839 2950 289096980 289097090 1.030000e-20 111.0
32 TraesCS1D01G047000 chr7D 83.438 320 41 9 125 439 107380847 107381159 1.600000e-73 287.0
33 TraesCS1D01G047000 chr5D 85.714 112 10 4 2841 2950 353692070 353692177 2.880000e-21 113.0
34 TraesCS1D01G047000 chr3B 82.353 119 16 3 2834 2950 560594477 560594362 8.060000e-17 99.0
35 TraesCS1D01G047000 chr2A 94.118 51 1 2 2842 2891 543156234 543156185 3.770000e-10 76.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G047000 chr1D 26689926 26693451 3525 False 705.755556 2988 94.904222 1 3526 9 chr1D.!!$F2 3525
1 TraesCS1D01G047000 chr1D 26675841 26679082 3241 False 626.330000 2750 92.498500 1 3526 10 chr1D.!!$F1 3525
2 TraesCS1D01G047000 chr1B 42324645 42328850 4205 False 470.250000 1199 86.365500 1 3526 12 chr1B.!!$F2 3525

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
516 518 2.498441 ACTTAGCACCATAATGGGGGA 58.502 47.619 0.00 0.0 42.59 4.81 F
1189 1221 2.416747 CCAAGAGTGCACATTTCTCGA 58.583 47.619 21.04 0.0 33.96 4.04 F
1213 1245 4.021925 GGAAGCTGCCTCGTGGGT 62.022 66.667 2.27 0.0 37.43 4.51 F
2318 2350 1.829523 TTCCTACCGGACCAAACCCG 61.830 60.000 9.46 0.0 46.10 5.28 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1582 1614 0.832135 ACCTTCCTGAGCACCGAGAA 60.832 55.000 0.00 0.00 0.00 2.87 R
2318 2350 2.202756 GGTGAGTCGGATGTCGCC 60.203 66.667 7.04 7.04 39.05 5.54 R
2339 2371 2.284699 AAGTCCCTCGGAGGTGGG 60.285 66.667 22.07 8.82 41.59 4.61 R
3331 4843 0.323725 ACCACATCCTCATGGGTTGC 60.324 55.000 9.81 0.00 40.59 4.17 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
238 239 4.980339 AAAGACAAAATTCTGGCCCAAT 57.020 36.364 0.00 0.00 0.00 3.16
337 338 9.486497 TGAATTTTTGCACACACATAATACAAT 57.514 25.926 0.00 0.00 0.00 2.71
516 518 2.498441 ACTTAGCACCATAATGGGGGA 58.502 47.619 0.00 0.00 42.59 4.81
672 674 4.723248 GGCAATTGAGCCGTATATTAAGC 58.277 43.478 10.34 0.00 46.12 3.09
1042 1068 3.066190 CACCGGCGGTACTCCTCA 61.066 66.667 33.65 0.00 32.11 3.86
1189 1221 2.416747 CCAAGAGTGCACATTTCTCGA 58.583 47.619 21.04 0.00 33.96 4.04
1213 1245 4.021925 GGAAGCTGCCTCGTGGGT 62.022 66.667 2.27 0.00 37.43 4.51
2318 2350 1.829523 TTCCTACCGGACCAAACCCG 61.830 60.000 9.46 0.00 46.10 5.28
2339 2371 3.718210 GACATCCGACTCACCGCCC 62.718 68.421 0.00 0.00 0.00 6.13
2785 4296 2.050985 GTGGCGTTGTCTGCTTGC 60.051 61.111 0.00 0.00 0.00 4.01
2915 4427 1.276622 GGGTAAAGAGCTCCTCCACA 58.723 55.000 10.93 0.00 0.00 4.17
3012 4524 6.408035 TGCGTATGTAAAACCTAATTCCTCA 58.592 36.000 0.00 0.00 0.00 3.86
3331 4843 0.744281 ACACCTCCCTTGCAAAAACG 59.256 50.000 0.00 0.00 0.00 3.60
3489 5001 4.009675 CCTTCGATTCCCAAGTGAATTCA 58.990 43.478 3.38 3.38 35.15 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
135 136 8.865090 ACATGTACAAGTTTCCATGGAATTTTA 58.135 29.630 27.53 14.05 39.14 1.52
173 174 6.976636 ATGTTTTCAAACGGTTTTTCACAT 57.023 29.167 2.79 7.36 41.74 3.21
491 493 4.278419 CCCCATTATGGTGCTAAGTTTAGC 59.722 45.833 15.24 15.24 44.35 3.09
1201 1233 2.262915 GTCTGACCCACGAGGCAG 59.737 66.667 0.00 0.00 40.58 4.85
1504 1536 3.090037 CCTTCCGGAGAACAGAGAAGTA 58.910 50.000 3.34 0.00 0.00 2.24
1582 1614 0.832135 ACCTTCCTGAGCACCGAGAA 60.832 55.000 0.00 0.00 0.00 2.87
2318 2350 2.202756 GGTGAGTCGGATGTCGCC 60.203 66.667 7.04 7.04 39.05 5.54
2339 2371 2.284699 AAGTCCCTCGGAGGTGGG 60.285 66.667 22.07 8.82 41.59 4.61
2785 4296 3.411351 CGGTGGAAGCAACGGACG 61.411 66.667 0.00 0.00 0.00 4.79
2864 4376 9.090692 TCTTTTCTTTAATACATAGTACGCACC 57.909 33.333 0.00 0.00 0.00 5.01
2915 4427 6.882678 GGGTTATGTAACTTGTAATCACCAGT 59.117 38.462 3.22 0.00 36.47 4.00
3012 4524 3.656457 TGGCAACATGAGCAGATGT 57.344 47.368 14.84 0.00 46.17 3.06
3331 4843 0.323725 ACCACATCCTCATGGGTTGC 60.324 55.000 9.81 0.00 40.59 4.17


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.