Multiple sequence alignment - TraesCS1D01G041100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G041100 chr1D 100.000 2493 0 0 1 2493 19993789 19991297 0 4604
1 TraesCS1D01G041100 chr1D 98.678 2497 29 3 1 2493 203582853 203585349 0 4425
2 TraesCS1D01G041100 chr3D 98.878 2496 25 3 1 2493 68827258 68824763 0 4451
3 TraesCS1D01G041100 chr7D 98.838 2496 25 4 1 2493 567322003 567324497 0 4446
4 TraesCS1D01G041100 chr7D 98.637 2495 30 4 1 2493 200270886 200273378 0 4416
5 TraesCS1D01G041100 chr5D 98.719 2498 25 6 1 2493 55023993 55021498 0 4429
6 TraesCS1D01G041100 chr5D 98.639 2499 26 5 1 2493 335823512 335826008 0 4420
7 TraesCS1D01G041100 chr4D 98.558 2496 32 3 1 2493 433308252 433305758 0 4407


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G041100 chr1D 19991297 19993789 2492 True 4604 4604 100.000 1 2493 1 chr1D.!!$R1 2492
1 TraesCS1D01G041100 chr1D 203582853 203585349 2496 False 4425 4425 98.678 1 2493 1 chr1D.!!$F1 2492
2 TraesCS1D01G041100 chr3D 68824763 68827258 2495 True 4451 4451 98.878 1 2493 1 chr3D.!!$R1 2492
3 TraesCS1D01G041100 chr7D 567322003 567324497 2494 False 4446 4446 98.838 1 2493 1 chr7D.!!$F2 2492
4 TraesCS1D01G041100 chr7D 200270886 200273378 2492 False 4416 4416 98.637 1 2493 1 chr7D.!!$F1 2492
5 TraesCS1D01G041100 chr5D 55021498 55023993 2495 True 4429 4429 98.719 1 2493 1 chr5D.!!$R1 2492
6 TraesCS1D01G041100 chr5D 335823512 335826008 2496 False 4420 4420 98.639 1 2493 1 chr5D.!!$F1 2492
7 TraesCS1D01G041100 chr4D 433305758 433308252 2494 True 4407 4407 98.558 1 2493 1 chr4D.!!$R1 2492

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
905 914 3.196685 CCCCATCTTCTCGTTCTTCTTCT 59.803 47.826 0.0 0.0 0.0 2.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2057 2071 7.933577 TGAAGTATTGGTTCTCTAGGCATAATG 59.066 37.037 0.0 0.0 0.0 1.9 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
709 718 3.880490 GACCACCACATGTCAGTGTTAAA 59.120 43.478 19.28 0.0 37.82 1.52
791 800 3.638160 CCTTCTCCTCTTCTCCATCTGAG 59.362 52.174 0.00 0.0 42.90 3.35
905 914 3.196685 CCCCATCTTCTCGTTCTTCTTCT 59.803 47.826 0.00 0.0 0.00 2.85
910 919 6.385843 CATCTTCTCGTTCTTCTTCTTCTCA 58.614 40.000 0.00 0.0 0.00 3.27
921 930 6.302269 TCTTCTTCTTCTCAAGCAATTCCTT 58.698 36.000 0.00 0.0 0.00 3.36
1151 1160 5.984725 TGAGTTTTCCTCGCATCCTTTATA 58.015 37.500 0.00 0.0 43.64 0.98
2282 2296 1.944024 TCAAACCAAAGCCGTGTACAG 59.056 47.619 0.00 0.0 0.00 2.74
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
791 800 1.005340 CTGCTCGATGCCTTTGTCTC 58.995 55.000 4.73 0.00 42.00 3.36
905 914 6.469782 AGAAACAAAGGAATTGCTTGAGAA 57.530 33.333 13.40 0.00 43.13 2.87
910 919 5.600069 AGAGGAAGAAACAAAGGAATTGCTT 59.400 36.000 6.36 6.36 43.13 3.91
1181 1190 5.451908 GCATTTCTTCACGATCTGAAAACA 58.548 37.500 8.36 0.00 38.47 2.83
2051 2065 8.721133 TTGGTTCTCTAGGCATAATGATACTA 57.279 34.615 0.00 0.00 0.00 1.82
2057 2071 7.933577 TGAAGTATTGGTTCTCTAGGCATAATG 59.066 37.037 0.00 0.00 0.00 1.90


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.