Multiple sequence alignment - TraesCS1D01G028100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G028100 chr1D 100.000 2255 0 0 1 2255 11133043 11130789 0.000000e+00 4165
1 TraesCS1D01G028100 chr1D 94.746 2284 86 10 1 2255 11051083 11048805 0.000000e+00 3522
2 TraesCS1D01G028100 chr1D 94.746 2284 87 9 1 2255 11098620 11096341 0.000000e+00 3522
3 TraesCS1D01G028100 chr1D 94.617 2285 89 11 1 2255 11013287 11011007 0.000000e+00 3507
4 TraesCS1D01G028100 chr1D 85.536 1362 158 28 118 1462 11207208 11205869 0.000000e+00 1387
5 TraesCS1D01G028100 chr1B 93.359 2304 79 11 1 2255 16503577 16501299 0.000000e+00 3339
6 TraesCS1D01G028100 chr1B 93.466 1714 75 13 1 1685 16659560 16657855 0.000000e+00 2510
7 TraesCS1D01G028100 chr1B 87.248 941 99 13 536 1462 17287753 17288686 0.000000e+00 1053
8 TraesCS1D01G028100 chr1B 89.474 817 81 5 536 1351 16668905 16668093 0.000000e+00 1027
9 TraesCS1D01G028100 chr1B 87.713 822 57 16 1 788 17332829 17332018 0.000000e+00 918
10 TraesCS1D01G028100 chr1B 93.986 582 33 2 1670 2251 16656506 16655927 0.000000e+00 880
11 TraesCS1D01G028100 chr1B 87.973 582 31 14 3 553 16669526 16668953 0.000000e+00 651
12 TraesCS1D01G028100 chr1B 87.822 583 31 18 3 553 17287131 17287705 0.000000e+00 647
13 TraesCS1D01G028100 chr1B 91.461 445 10 3 1 421 16635385 16634945 8.970000e-164 586
14 TraesCS1D01G028100 chr1B 82.531 561 76 15 1685 2238 17288780 17289325 7.290000e-130 473
15 TraesCS1D01G028100 chrUn 94.378 2081 78 13 178 2255 159672 157628 0.000000e+00 3158
16 TraesCS1D01G028100 chr1A 89.993 1529 102 20 1 1482 22626159 22627683 0.000000e+00 1929
17 TraesCS1D01G028100 chr1A 92.494 413 31 0 1843 2255 22628141 22628553 1.930000e-165 592
18 TraesCS1D01G028100 chr1A 90.798 163 15 0 1631 1793 22627842 22628004 3.770000e-53 219
19 TraesCS1D01G028100 chr7B 88.824 170 15 4 1474 1640 490207991 490208159 2.940000e-49 206
20 TraesCS1D01G028100 chr7D 88.372 172 14 6 1474 1640 465477784 465477954 3.800000e-48 202
21 TraesCS1D01G028100 chr5A 88.344 163 15 4 1474 1633 320214404 320214243 2.290000e-45 193
22 TraesCS1D01G028100 chr2A 88.344 163 13 5 1474 1633 7921049 7920890 8.220000e-45 191


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G028100 chr1D 11130789 11133043 2254 True 4165.000000 4165 100.0000 1 2255 1 chr1D.!!$R4 2254
1 TraesCS1D01G028100 chr1D 11048805 11051083 2278 True 3522.000000 3522 94.7460 1 2255 1 chr1D.!!$R2 2254
2 TraesCS1D01G028100 chr1D 11096341 11098620 2279 True 3522.000000 3522 94.7460 1 2255 1 chr1D.!!$R3 2254
3 TraesCS1D01G028100 chr1D 11011007 11013287 2280 True 3507.000000 3507 94.6170 1 2255 1 chr1D.!!$R1 2254
4 TraesCS1D01G028100 chr1D 11205869 11207208 1339 True 1387.000000 1387 85.5360 118 1462 1 chr1D.!!$R5 1344
5 TraesCS1D01G028100 chr1B 16501299 16503577 2278 True 3339.000000 3339 93.3590 1 2255 1 chr1B.!!$R1 2254
6 TraesCS1D01G028100 chr1B 16655927 16659560 3633 True 1695.000000 2510 93.7260 1 2251 2 chr1B.!!$R4 2250
7 TraesCS1D01G028100 chr1B 17332018 17332829 811 True 918.000000 918 87.7130 1 788 1 chr1B.!!$R3 787
8 TraesCS1D01G028100 chr1B 16668093 16669526 1433 True 839.000000 1027 88.7235 3 1351 2 chr1B.!!$R5 1348
9 TraesCS1D01G028100 chr1B 17287131 17289325 2194 False 724.333333 1053 85.8670 3 2238 3 chr1B.!!$F1 2235
10 TraesCS1D01G028100 chrUn 157628 159672 2044 True 3158.000000 3158 94.3780 178 2255 1 chrUn.!!$R1 2077
11 TraesCS1D01G028100 chr1A 22626159 22628553 2394 False 913.333333 1929 91.0950 1 2255 3 chr1A.!!$F1 2254

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
616 733 1.164411 TCCATGATGTTCCGTGCAAC 58.836 50.0 0.0 0.0 0.0 4.17 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2007 3815 0.912487 ACCTTCCCATGGGCTCGTTA 60.912 55.0 27.41 4.4 34.68 3.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
100 109 8.814038 AGCTAGATATTAATTTAATGGCCAGG 57.186 34.615 13.05 0.00 0.00 4.45
345 383 4.469657 TGTAGTGCAAACTTGAAGGGAAT 58.530 39.130 0.00 0.00 0.00 3.01
353 391 7.440856 GTGCAAACTTGAAGGGAATGAAATAAA 59.559 33.333 0.00 0.00 0.00 1.40
354 392 7.989741 TGCAAACTTGAAGGGAATGAAATAAAA 59.010 29.630 0.00 0.00 0.00 1.52
476 520 9.780413 CTGATTCTTTATGCTAAGAAAAGTTCC 57.220 33.333 11.40 2.19 44.68 3.62
523 571 3.489785 CAGTGTCGTGTTCTCCTACAAAC 59.510 47.826 0.00 0.00 0.00 2.93
616 733 1.164411 TCCATGATGTTCCGTGCAAC 58.836 50.000 0.00 0.00 0.00 4.17
640 757 3.507162 TCATTCACCCTTTTCTGCTCA 57.493 42.857 0.00 0.00 0.00 4.26
699 819 9.741647 GTAGGCACGTAATACTCTAAATAAAGT 57.258 33.333 0.00 0.00 0.00 2.66
724 844 3.904800 TGGGATATCTTCGTTCAAGCA 57.095 42.857 2.05 0.00 31.26 3.91
882 1025 3.935203 CAGTCACACAGGCGATTTAATCT 59.065 43.478 3.34 0.00 0.00 2.40
998 1144 3.384146 TCAAAGGAAGCAAGCATCACAAA 59.616 39.130 0.00 0.00 0.00 2.83
1084 1230 2.140792 ACGGAGTGGCCAGAGTTGT 61.141 57.895 5.11 0.00 42.51 3.32
1104 1250 1.689582 GGGGAAGTCGGTGGAGGAT 60.690 63.158 0.00 0.00 0.00 3.24
1254 1400 2.686106 GTCCCCAGGGTCGGCTAA 60.686 66.667 4.22 0.00 36.47 3.09
1489 1821 4.142004 ACCATACACTCCATCCGTTCTAAC 60.142 45.833 0.00 0.00 0.00 2.34
1526 1858 6.656902 AGAGATTTCAATAAGGACTGCATGA 58.343 36.000 0.00 0.00 0.00 3.07
1734 3450 6.128363 CCGTCAAAACCATAAAAGTAGGAGAC 60.128 42.308 0.00 0.00 0.00 3.36
1817 3534 1.152567 CCCACCTTTTGCCAGGACA 60.153 57.895 0.00 0.00 37.39 4.02
2007 3815 2.490903 GAGAATTGCACATCACTGCCTT 59.509 45.455 0.00 0.00 36.21 4.35
2010 3818 3.855689 ATTGCACATCACTGCCTTAAC 57.144 42.857 0.00 0.00 36.21 2.01
2040 3849 6.183361 CCATGGGAAGGTCTGACATATCTTAA 60.183 42.308 10.38 0.00 0.00 1.85
2078 3888 6.157471 CCCTCATATCCAGATGACCATTATCA 59.843 42.308 0.00 0.00 32.39 2.15
2204 4014 2.618241 TCGCTCAAAGTGTTGCTTCATT 59.382 40.909 0.00 0.00 36.17 2.57
2238 4048 1.615424 GGGGAGGAGGCCTAACACA 60.615 63.158 4.42 0.00 31.76 3.72
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
450 494 9.780413 GGAACTTTTCTTAGCATAAAGAATCAG 57.220 33.333 9.00 10.11 43.21 2.90
476 520 3.926616 ACAACTCAACCAGACGGATAAG 58.073 45.455 0.00 0.00 35.59 1.73
523 571 2.053865 ATCACATGCCCGGCCTTTG 61.054 57.895 7.03 4.77 0.00 2.77
616 733 5.143376 AGCAGAAAAGGGTGAATGAAATG 57.857 39.130 0.00 0.00 0.00 2.32
640 757 8.928448 TCAGATAAAGTGATGCTTATCTACCTT 58.072 33.333 4.48 0.00 36.17 3.50
699 819 5.296780 GCTTGAACGAAGATATCCCATTTGA 59.703 40.000 0.00 0.00 32.82 2.69
724 844 2.978156 ACTTCACATGGATGGTGGTT 57.022 45.000 0.00 0.00 36.90 3.67
797 940 1.519719 GGCAATCAGGCTCGACTCT 59.480 57.895 0.00 0.00 40.24 3.24
882 1025 3.709141 TGCACATACTAACCTATGAGGCA 59.291 43.478 0.00 0.00 39.63 4.75
998 1144 4.802248 GCTTCTTCACCACAGAACTCATCT 60.802 45.833 0.00 0.00 39.68 2.90
1059 1205 0.895530 CTGGCCACTCCGTCTTCTTA 59.104 55.000 0.00 0.00 37.80 2.10
1060 1206 0.832135 TCTGGCCACTCCGTCTTCTT 60.832 55.000 0.00 0.00 37.80 2.52
1084 1230 2.221299 CCTCCACCGACTTCCCCAA 61.221 63.158 0.00 0.00 0.00 4.12
1104 1250 2.036217 CTGCAAAATCACCTTCTTGGCA 59.964 45.455 0.00 0.00 40.22 4.92
1164 1310 6.587273 TCGATATTCCATGGTCACAATTGTA 58.413 36.000 11.53 0.00 0.00 2.41
1254 1400 3.454082 AGCAGGCTAGATCTTAAGCTTGT 59.546 43.478 23.17 12.28 44.93 3.16
1356 1515 4.345288 CATTCACTTACCATGCATCAACG 58.655 43.478 0.00 0.00 0.00 4.10
1569 1901 7.649533 TCCAATAAGGAACTACATACGAAGA 57.350 36.000 0.00 0.00 45.65 2.87
1734 3450 4.162320 TCAGCTCTCATTTTACTAGGTGGG 59.838 45.833 0.00 0.00 36.56 4.61
1770 3486 4.481368 AGGATACCAACATCGTTGCTTA 57.519 40.909 1.26 0.00 37.17 3.09
1817 3534 2.796500 TTTTTCTTTGGGGACGCGT 58.204 47.368 13.85 13.85 0.00 6.01
2007 3815 0.912487 ACCTTCCCATGGGCTCGTTA 60.912 55.000 27.41 4.40 34.68 3.18
2010 3818 2.190578 GACCTTCCCATGGGCTCG 59.809 66.667 27.41 16.73 34.68 5.03
2040 3849 1.075601 ATGAGGGGACACACCAATGT 58.924 50.000 0.00 0.00 40.80 2.71
2204 4014 2.283532 CCGGGGTTCATTGGGCAA 60.284 61.111 0.00 0.00 0.00 4.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.