Multiple sequence alignment - TraesCS1D01G015200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G015200 chr1D 100.000 2254 0 0 925 3178 7180817 7183070 0.000000e+00 4163
1 TraesCS1D01G015200 chr1D 94.432 2299 76 15 925 3178 42896938 42894647 0.000000e+00 3489
2 TraesCS1D01G015200 chr1D 97.849 1395 23 4 939 2330 4307997 4306607 0.000000e+00 2403
3 TraesCS1D01G015200 chr1D 100.000 607 0 0 1 607 7179893 7180499 0.000000e+00 1122
4 TraesCS1D01G015200 chr1D 96.918 584 11 4 1 583 4308840 4308263 0.000000e+00 972
5 TraesCS1D01G015200 chr1D 95.860 314 12 1 290 602 4300780 4301093 1.020000e-139 507
6 TraesCS1D01G015200 chr1D 92.212 321 21 4 285 602 42889393 42889712 4.830000e-123 451
7 TraesCS1D01G015200 chr1D 90.311 289 28 0 1 289 3859646 3859934 2.310000e-101 379
8 TraesCS1D01G015200 chr2D 97.693 2254 43 2 925 3178 380678434 380680678 0.000000e+00 3866
9 TraesCS1D01G015200 chr4D 97.249 2254 46 2 925 3178 108842549 108844786 0.000000e+00 3805
10 TraesCS1D01G015200 chr4D 96.215 317 11 1 292 607 108842224 108842540 4.700000e-143 518
11 TraesCS1D01G015200 chr4D 95.710 303 12 1 291 592 108850297 108849995 1.330000e-133 486
12 TraesCS1D01G015200 chr3D 97.204 2253 50 4 928 3178 590153646 590155887 0.000000e+00 3799
13 TraesCS1D01G015200 chr3D 96.991 2260 44 7 925 3178 594954592 594952351 0.000000e+00 3775
14 TraesCS1D01G015200 chr3D 94.044 319 14 4 287 603 594947118 594947433 2.220000e-131 479
15 TraesCS1D01G015200 chr3D 93.082 318 16 5 292 607 590160366 590160053 8.030000e-126 460
16 TraesCS1D01G015200 chr5D 96.884 2054 56 2 1127 3178 449488326 449490373 0.000000e+00 3432
17 TraesCS1D01G015200 chr5D 97.844 1067 22 1 925 1991 406899795 406900860 0.000000e+00 1842
18 TraesCS1D01G015200 chr5D 92.767 318 16 5 292 607 449495587 449495275 1.340000e-123 453
19 TraesCS1D01G015200 chr1A 93.440 2302 82 26 934 3178 572001083 571998794 0.000000e+00 3350
20 TraesCS1D01G015200 chr1A 90.526 285 27 0 1 285 6511038 6510754 8.320000e-101 377
21 TraesCS1D01G015200 chr1A 83.045 289 46 2 1 289 5152929 5153214 3.140000e-65 259
22 TraesCS1D01G015200 chr1B 90.144 2293 133 31 939 3178 539849603 539847351 0.000000e+00 2896
23 TraesCS1D01G015200 chr5A 96.207 1661 52 3 1520 3178 573011283 573009632 0.000000e+00 2708
24 TraesCS1D01G015200 chr5A 92.722 316 19 4 292 605 573012214 573011901 1.340000e-123 453
25 TraesCS1D01G015200 chr7D 97.309 892 12 3 948 1839 123498449 123497570 0.000000e+00 1504


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G015200 chr1D 7179893 7183070 3177 False 2642.5 4163 100.0000 1 3178 2 chr1D.!!$F4 3177
1 TraesCS1D01G015200 chr1D 42894647 42896938 2291 True 3489.0 3489 94.4320 925 3178 1 chr1D.!!$R1 2253
2 TraesCS1D01G015200 chr1D 4306607 4308840 2233 True 1687.5 2403 97.3835 1 2330 2 chr1D.!!$R2 2329
3 TraesCS1D01G015200 chr2D 380678434 380680678 2244 False 3866.0 3866 97.6930 925 3178 1 chr2D.!!$F1 2253
4 TraesCS1D01G015200 chr4D 108842224 108844786 2562 False 2161.5 3805 96.7320 292 3178 2 chr4D.!!$F1 2886
5 TraesCS1D01G015200 chr3D 590153646 590155887 2241 False 3799.0 3799 97.2040 928 3178 1 chr3D.!!$F1 2250
6 TraesCS1D01G015200 chr3D 594952351 594954592 2241 True 3775.0 3775 96.9910 925 3178 1 chr3D.!!$R2 2253
7 TraesCS1D01G015200 chr5D 449488326 449490373 2047 False 3432.0 3432 96.8840 1127 3178 1 chr5D.!!$F2 2051
8 TraesCS1D01G015200 chr5D 406899795 406900860 1065 False 1842.0 1842 97.8440 925 1991 1 chr5D.!!$F1 1066
9 TraesCS1D01G015200 chr1A 571998794 572001083 2289 True 3350.0 3350 93.4400 934 3178 1 chr1A.!!$R2 2244
10 TraesCS1D01G015200 chr1B 539847351 539849603 2252 True 2896.0 2896 90.1440 939 3178 1 chr1B.!!$R1 2239
11 TraesCS1D01G015200 chr5A 573009632 573012214 2582 True 1580.5 2708 94.4645 292 3178 2 chr5A.!!$R1 2886
12 TraesCS1D01G015200 chr7D 123497570 123498449 879 True 1504.0 1504 97.3090 948 1839 1 chr7D.!!$R1 891

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
966 973 0.332972 TCTGCTCTCCACTGCTCCTA 59.667 55.0 0.0 0.0 0.0 2.94 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2905 3018 1.139734 CACTACGTCGCTCCAGCAT 59.86 57.895 0.0 0.0 42.21 3.79 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
24 25 1.602605 GTGGCAGTAGCGGGGTTTT 60.603 57.895 0.00 0.00 43.41 2.43
137 138 0.813184 CAGAGGCGATTTGGTGCAAT 59.187 50.000 0.00 0.00 0.00 3.56
377 379 7.418337 AACTGACCAAAAACTCCAGTTTATT 57.582 32.000 5.13 0.77 46.47 1.40
391 393 5.647658 TCCAGTTTATTGCTGATTTCGTGAT 59.352 36.000 0.00 0.00 36.12 3.06
473 475 2.747686 GCCCACCTTTCAGGACGA 59.252 61.111 0.00 0.00 37.67 4.20
966 973 0.332972 TCTGCTCTCCACTGCTCCTA 59.667 55.000 0.00 0.00 0.00 2.94
1151 1169 5.736616 AGGGTTAGGGTTTGAAGAAGGATAT 59.263 40.000 0.00 0.00 0.00 1.63
1641 1698 3.576078 TTCAGGATGGTGTGAACTGTT 57.424 42.857 0.00 0.00 36.16 3.16
2163 2224 8.457238 AAAGCTAGACAAGATCAAAGAAGTTT 57.543 30.769 0.00 0.00 0.00 2.66
2168 2229 9.823098 CTAGACAAGATCAAAGAAGTTTTCATG 57.177 33.333 0.00 0.00 0.00 3.07
2328 2400 1.924731 TTGGTTGTGTTGTTGGGTGA 58.075 45.000 0.00 0.00 0.00 4.02
2738 2839 0.387202 CTGAGCATCGTACCTCCTGG 59.613 60.000 0.00 0.00 38.61 4.45
2759 2860 0.902531 TCACTTCGGTGGGAGGATTC 59.097 55.000 0.00 0.00 45.34 2.52
2766 2867 2.688666 TGGGAGGATTCGGCAGCT 60.689 61.111 0.00 0.00 0.00 4.24
2905 3018 3.312421 GCATTTGCTTCAGCCGTAGATTA 59.688 43.478 0.00 0.00 41.18 1.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
24 25 4.620567 CGACTGGACTGTAATTGATGGACA 60.621 45.833 0.00 0.0 0.00 4.02
137 138 3.810941 CCGAGGTTAACTTGCACTTGTAA 59.189 43.478 5.42 0.0 0.00 2.41
966 973 1.134965 CCGGAGTGCGAGAAGAAGAAT 60.135 52.381 5.27 0.0 0.00 2.40
1151 1169 9.699410 ATACATGAACTTAAATGGAGAAATCCA 57.301 29.630 0.00 0.0 44.85 3.41
1286 1310 4.463879 CAGCCCTCTCCCTGTGCG 62.464 72.222 0.00 0.0 0.00 5.34
1641 1698 4.564821 GGCATCTACCCACTCTAAAACACA 60.565 45.833 0.00 0.0 0.00 3.72
1935 1996 6.211986 TCCATTTGAATCTCAATCTTTGCCTT 59.788 34.615 0.00 0.0 36.11 4.35
2163 2224 2.338809 ACCACTTCACTCCTCCATGAA 58.661 47.619 0.00 0.0 33.82 2.57
2168 2229 1.939980 AGGTACCACTTCACTCCTCC 58.060 55.000 15.94 0.0 0.00 4.30
2328 2400 5.319453 CATTACAGATCAGGGGCATTACAT 58.681 41.667 0.00 0.0 0.00 2.29
2371 2443 3.814504 ATATGGTTCAGGGGGCATTAG 57.185 47.619 0.00 0.0 0.00 1.73
2563 2647 7.226441 TGTAATGCTATCTATGTTGCATCCTT 58.774 34.615 0.00 0.0 44.15 3.36
2766 2867 2.050144 AGAAGAACAGGAGGTGCAGAA 58.950 47.619 0.00 0.0 0.00 3.02
2905 3018 1.139734 CACTACGTCGCTCCAGCAT 59.860 57.895 0.00 0.0 42.21 3.79
3001 3114 1.122019 CCGAGGTAAGGGGATCCTGG 61.122 65.000 12.58 0.0 44.07 4.45


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.