Multiple sequence alignment - TraesCS1D01G015100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G015100 chr1D 100.000 2869 0 0 1 2869 7157709 7154841 0.000000e+00 5299.0
1 TraesCS1D01G015100 chr1D 97.053 2884 58 18 1 2860 4340665 4343545 0.000000e+00 4830.0
2 TraesCS1D01G015100 chr1D 88.259 1218 102 23 741 1933 99010 100211 0.000000e+00 1419.0
3 TraesCS1D01G015100 chr1D 82.807 1553 198 43 1238 2758 5139250 5140765 0.000000e+00 1325.0
4 TraesCS1D01G015100 chr1D 83.901 1410 155 42 1371 2758 5356899 5358258 0.000000e+00 1280.0
5 TraesCS1D01G015100 chr1D 83.103 1373 160 34 1394 2758 3710386 3709078 0.000000e+00 1184.0
6 TraesCS1D01G015100 chr1D 81.541 1376 173 36 1394 2758 3826163 3824858 0.000000e+00 1059.0
7 TraesCS1D01G015100 chr1D 84.726 838 91 27 742 1558 5138785 5139606 0.000000e+00 804.0
8 TraesCS1D01G015100 chr1D 84.127 819 93 10 1977 2788 100219 101007 0.000000e+00 758.0
9 TraesCS1D01G015100 chr1D 86.534 401 46 5 339 732 98696 99095 4.980000e-118 435.0
10 TraesCS1D01G015100 chr1D 100.000 159 0 0 3095 3253 7154615 7154457 8.830000e-76 294.0
11 TraesCS1D01G015100 chr1D 98.742 159 2 0 3095 3253 4343823 4343981 1.910000e-72 283.0
12 TraesCS1D01G015100 chr1D 91.667 96 7 1 742 836 4341312 4341407 7.320000e-27 132.0
13 TraesCS1D01G015100 chr1D 91.667 96 7 1 742 836 7157063 7156968 7.320000e-27 132.0
14 TraesCS1D01G015100 chr1B 94.120 2874 133 14 1 2869 22184643 22187485 0.000000e+00 4338.0
15 TraesCS1D01G015100 chr1B 93.289 2876 140 13 1 2869 6438565 6435736 0.000000e+00 4193.0
16 TraesCS1D01G015100 chr1B 87.407 1215 119 16 742 1936 5521102 5519902 0.000000e+00 1365.0
17 TraesCS1D01G015100 chr1B 85.942 1252 129 32 742 1954 5688038 5686795 0.000000e+00 1293.0
18 TraesCS1D01G015100 chr1B 88.636 660 53 13 742 1382 5585822 5585166 0.000000e+00 784.0
19 TraesCS1D01G015100 chr1B 83.902 820 94 10 1976 2788 5584365 5583577 0.000000e+00 749.0
20 TraesCS1D01G015100 chr1B 87.531 401 43 6 339 733 5688351 5687952 1.060000e-124 457.0
21 TraesCS1D01G015100 chr1B 92.453 159 12 0 3095 3253 22187539 22187697 9.080000e-56 228.0
22 TraesCS1D01G015100 chr1B 84.500 200 20 10 346 536 5586084 5585887 1.540000e-43 187.0
23 TraesCS1D01G015100 chr1B 96.460 113 4 0 3096 3208 6435680 6435568 1.540000e-43 187.0
24 TraesCS1D01G015100 chr1B 88.816 152 15 2 583 733 5585886 5585736 5.540000e-43 185.0
25 TraesCS1D01G015100 chr1B 89.362 94 6 4 3097 3189 7314331 7314241 7.380000e-22 115.0
26 TraesCS1D01G015100 chr1A 84.660 1382 152 30 1389 2758 6517588 6518921 0.000000e+00 1323.0
27 TraesCS1D01G015100 chr1A 83.413 1049 107 30 1368 2410 6561932 6562919 0.000000e+00 911.0
28 TraesCS1D01G015100 chr1A 84.414 802 85 15 1998 2788 4095906 4095134 0.000000e+00 752.0
29 TraesCS1D01G015100 chr1A 83.784 740 105 10 2 733 6516431 6517163 0.000000e+00 688.0
30 TraesCS1D01G015100 chr1A 84.685 666 80 16 742 1398 6561451 6562103 0.000000e+00 645.0
31 TraesCS1D01G015100 chr1A 84.987 393 50 7 347 733 4097476 4097087 1.090000e-104 390.0
32 TraesCS1D01G015100 chr1A 86.471 340 42 4 397 733 6561199 6561537 1.430000e-98 370.0
33 TraesCS1D01G015100 chrUn 100.000 385 0 0 2293 2677 480721449 480721833 0.000000e+00 712.0
34 TraesCS1D01G015100 chr3D 91.045 67 6 0 3187 3253 30038419 30038353 1.240000e-14 91.6


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G015100 chr1D 7154457 7157709 3252 True 1908.333333 5299 97.222333 1 3253 3 chr1D.!!$R3 3252
1 TraesCS1D01G015100 chr1D 4340665 4343981 3316 False 1748.333333 4830 95.820667 1 3253 3 chr1D.!!$F3 3252
2 TraesCS1D01G015100 chr1D 5356899 5358258 1359 False 1280.000000 1280 83.901000 1371 2758 1 chr1D.!!$F1 1387
3 TraesCS1D01G015100 chr1D 3709078 3710386 1308 True 1184.000000 1184 83.103000 1394 2758 1 chr1D.!!$R1 1364
4 TraesCS1D01G015100 chr1D 5138785 5140765 1980 False 1064.500000 1325 83.766500 742 2758 2 chr1D.!!$F4 2016
5 TraesCS1D01G015100 chr1D 3824858 3826163 1305 True 1059.000000 1059 81.541000 1394 2758 1 chr1D.!!$R2 1364
6 TraesCS1D01G015100 chr1D 98696 101007 2311 False 870.666667 1419 86.306667 339 2788 3 chr1D.!!$F2 2449
7 TraesCS1D01G015100 chr1B 22184643 22187697 3054 False 2283.000000 4338 93.286500 1 3253 2 chr1B.!!$F1 3252
8 TraesCS1D01G015100 chr1B 6435568 6438565 2997 True 2190.000000 4193 94.874500 1 3208 2 chr1B.!!$R5 3207
9 TraesCS1D01G015100 chr1B 5519902 5521102 1200 True 1365.000000 1365 87.407000 742 1936 1 chr1B.!!$R1 1194
10 TraesCS1D01G015100 chr1B 5686795 5688351 1556 True 875.000000 1293 86.736500 339 1954 2 chr1B.!!$R4 1615
11 TraesCS1D01G015100 chr1B 5583577 5586084 2507 True 476.250000 784 86.463500 346 2788 4 chr1B.!!$R3 2442
12 TraesCS1D01G015100 chr1A 6516431 6518921 2490 False 1005.500000 1323 84.222000 2 2758 2 chr1A.!!$F1 2756
13 TraesCS1D01G015100 chr1A 6561199 6562919 1720 False 642.000000 911 84.856333 397 2410 3 chr1A.!!$F2 2013
14 TraesCS1D01G015100 chr1A 4095134 4097476 2342 True 571.000000 752 84.700500 347 2788 2 chr1A.!!$R1 2441

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
993 1023 1.707427 AGAAGGAAAGAGGTGGTGCAT 59.293 47.619 0.0 0.0 0.0 3.96 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2825 3660 3.374058 CCTTTTCCGTACCTAGCACAATG 59.626 47.826 0.0 0.0 0.0 2.82 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
473 489 9.982651 TGCTCTATAGGTGTCAATTTATCTTAC 57.017 33.333 0.00 0.0 0.00 2.34
993 1023 1.707427 AGAAGGAAAGAGGTGGTGCAT 59.293 47.619 0.00 0.0 0.00 3.96
1231 1265 1.512156 GGTACCACCAACAGCAACCG 61.512 60.000 7.15 0.0 38.42 4.44
1404 2055 1.138459 CGCAGCAACAACAACCACA 59.862 52.632 0.00 0.0 0.00 4.17
1411 2062 3.616379 AGCAACAACAACCACAATTTTCG 59.384 39.130 0.00 0.0 0.00 3.46
1422 2094 2.602211 CACAATTTTCGCAGCAACAACA 59.398 40.909 0.00 0.0 0.00 3.33
1455 2127 3.627577 CAGCAACAACAACCACTTCTACT 59.372 43.478 0.00 0.0 0.00 2.57
2825 3660 5.679734 ATCGCTACATCAATCCAACAATC 57.320 39.130 0.00 0.0 0.00 2.67
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
993 1023 8.492415 ACTTCATGTCTATTTATAGTAGCCCA 57.508 34.615 0.00 0.0 0.00 5.36
1117 1148 2.956987 GCAATGGCACTTGTCGCT 59.043 55.556 0.00 0.0 40.72 4.93
1231 1265 2.428890 TGGTTGTGGTTGTTGTTGGATC 59.571 45.455 0.00 0.0 0.00 3.36
1404 2055 2.607180 GGTTGTTGTTGCTGCGAAAATT 59.393 40.909 0.00 0.0 0.00 1.82
1411 2062 1.501169 GGAATGGTTGTTGTTGCTGC 58.499 50.000 0.00 0.0 0.00 5.25
1422 2094 1.112315 TTGTTGCTGCGGGAATGGTT 61.112 50.000 1.67 0.0 0.00 3.67
1455 2127 1.139853 GTGAAAATGGGGGTTGTTGCA 59.860 47.619 0.00 0.0 0.00 4.08
2687 3509 4.639135 AGCTGGACTTTTTCTTGACAAC 57.361 40.909 0.00 0.0 0.00 3.32
2825 3660 3.374058 CCTTTTCCGTACCTAGCACAATG 59.626 47.826 0.00 0.0 0.00 2.82
3099 3977 6.924913 ATGTGGTATAGTATGAGAGCATGT 57.075 37.500 0.00 0.0 35.94 3.21


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.