Multiple sequence alignment - TraesCS1D01G009100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1D01G009100 chr1D 100.000 8455 0 0 1 8455 4820227 4828681 0.000000e+00 15614
1 TraesCS1D01G009100 chr1D 98.579 985 9 3 7474 8455 457023038 457024020 0.000000e+00 1736
2 TraesCS1D01G009100 chr1D 85.669 1256 147 21 2550 3789 4821327 4822565 0.000000e+00 1291
3 TraesCS1D01G009100 chr1D 85.669 1256 147 22 1101 2339 4822776 4824015 0.000000e+00 1291
4 TraesCS1D01G009100 chr1D 78.827 2012 291 73 1844 3789 4821342 4823284 0.000000e+00 1230
5 TraesCS1D01G009100 chr1D 80.228 1401 196 46 5289 6683 4769091 4770416 0.000000e+00 977
6 TraesCS1D01G009100 chr1D 81.404 1097 173 19 6306 7398 90150886 90151955 0.000000e+00 867
7 TraesCS1D01G009100 chr1D 83.433 839 113 14 5048 5879 4821958 4822777 0.000000e+00 756
8 TraesCS1D01G009100 chr1D 83.433 839 113 14 1732 2551 4825274 4826105 0.000000e+00 756
9 TraesCS1D01G009100 chr1D 87.599 629 68 5 6772 7399 4774289 4774908 0.000000e+00 721
10 TraesCS1D01G009100 chr1D 80.507 867 128 26 2445 3299 4825271 4826108 2.000000e-175 627
11 TraesCS1D01G009100 chr1D 81.830 743 94 23 5160 5882 4821346 4822067 3.400000e-163 586
12 TraesCS1D01G009100 chr1D 81.830 743 94 23 1120 1841 4825386 4826108 3.400000e-163 586
13 TraesCS1D01G009100 chr1D 82.540 567 76 12 5762 6309 90150068 90150630 2.140000e-130 477
14 TraesCS1D01G009100 chr1D 77.310 736 138 18 6644 7352 10154339 10153606 2.840000e-109 407
15 TraesCS1D01G009100 chr1D 86.006 343 42 1 1234 1570 4769080 4769422 6.240000e-96 363
16 TraesCS1D01G009100 chr1D 78.846 468 66 21 3302 3757 90148764 90149210 1.390000e-72 285
17 TraesCS1D01G009100 chr1D 81.919 271 45 2 7081 7347 10070161 10069891 8.540000e-55 226
18 TraesCS1D01G009100 chr1B 97.025 2891 68 7 4587 7462 22704760 22707647 0.000000e+00 4846
19 TraesCS1D01G009100 chr1B 96.444 2784 82 6 4694 7462 7992963 7995744 0.000000e+00 4577
20 TraesCS1D01G009100 chr1B 95.369 2224 93 4 2358 4580 7990686 7992900 0.000000e+00 3528
21 TraesCS1D01G009100 chr1B 95.099 2224 99 4 2358 4580 22702427 22704641 0.000000e+00 3494
22 TraesCS1D01G009100 chr1B 95.096 2080 59 13 320 2372 22700348 22702411 0.000000e+00 3236
23 TraesCS1D01G009100 chr1B 97.657 811 16 2 1563 2372 7989862 7990670 0.000000e+00 1389
24 TraesCS1D01G009100 chr1B 81.401 1656 251 32 5769 7398 144930315 144931939 0.000000e+00 1299
25 TraesCS1D01G009100 chr1B 97.333 750 19 1 823 1571 7988920 7989669 0.000000e+00 1273
26 TraesCS1D01G009100 chr1B 84.952 1256 156 22 2550 3789 22701140 22702378 0.000000e+00 1242
27 TraesCS1D01G009100 chr1B 84.634 1256 161 21 1101 2339 7990876 7992116 0.000000e+00 1221
28 TraesCS1D01G009100 chr1B 84.064 1255 170 19 1101 2339 22702617 22703857 0.000000e+00 1182
29 TraesCS1D01G009100 chr1B 86.410 780 89 8 3023 3789 7989862 7990637 0.000000e+00 837
30 TraesCS1D01G009100 chr1B 84.019 851 114 9 5048 5879 22701771 22702618 0.000000e+00 798
31 TraesCS1D01G009100 chr1B 95.158 475 21 1 1 473 7988290 7988764 0.000000e+00 749
32 TraesCS1D01G009100 chr1B 83.075 839 116 14 1732 2551 22705220 22706051 0.000000e+00 739
33 TraesCS1D01G009100 chr1B 80.046 867 132 26 2445 3299 7993313 7994150 9.390000e-169 604
34 TraesCS1D01G009100 chr1B 81.536 742 98 19 1120 1841 22705332 22706054 7.360000e-160 575
35 TraesCS1D01G009100 chr1B 82.500 600 89 7 5048 5640 7991517 7992107 5.850000e-141 512
36 TraesCS1D01G009100 chr1B 81.500 600 95 7 5048 5640 22703258 22703848 5.940000e-131 479
37 TraesCS1D01G009100 chr1B 84.082 490 58 10 2550 3035 7989199 7989672 1.000000e-123 455
38 TraesCS1D01G009100 chr1B 84.960 379 48 5 1211 1583 144929799 144930174 8.010000e-100 375
39 TraesCS1D01G009100 chr1B 97.419 155 3 1 633 787 7988768 7988921 6.510000e-66 263
40 TraesCS1D01G009100 chr1B 80.618 356 55 10 3432 3776 144926621 144926973 6.510000e-66 263
41 TraesCS1D01G009100 chr1B 83.871 248 30 8 5638 5882 7989899 7990139 2.370000e-55 228
42 TraesCS1D01G009100 chr1B 88.596 114 12 1 5045 5158 7994041 7994153 4.120000e-28 137
43 TraesCS1D01G009100 chr1A 94.586 2863 97 19 4631 7473 6321582 6324406 0.000000e+00 4375
44 TraesCS1D01G009100 chr1A 95.079 2154 76 11 248 2372 6317016 6319168 0.000000e+00 3363
45 TraesCS1D01G009100 chr1A 96.608 1651 54 2 2369 4017 6319193 6320843 0.000000e+00 2737
46 TraesCS1D01G009100 chr1A 81.675 1648 241 38 5769 7390 86238590 86240202 0.000000e+00 1314
47 TraesCS1D01G009100 chr1A 85.692 1258 145 24 1101 2339 6319374 6320615 0.000000e+00 1293
48 TraesCS1D01G009100 chr1A 79.959 1462 225 43 2368 3789 6318449 6319882 0.000000e+00 1014
49 TraesCS1D01G009100 chr1A 84.272 852 110 10 5048 5879 6318528 6319375 0.000000e+00 809
50 TraesCS1D01G009100 chr1A 94.068 472 17 3 4073 4544 6321121 6321581 0.000000e+00 706
51 TraesCS1D01G009100 chr1A 80.345 870 126 28 5045 5882 6319269 6320125 1.210000e-172 617
52 TraesCS1D01G009100 chr1A 81.267 742 102 21 5160 5882 6317914 6318637 4.430000e-157 566
53 TraesCS1D01G009100 chr1A 78.563 863 134 32 2445 3299 6321978 6322797 9.730000e-144 521
54 TraesCS1D01G009100 chr1A 94.366 142 5 3 121 259 6301202 6301343 1.850000e-51 215
55 TraesCS1D01G009100 chr4D 98.580 986 9 3 7474 8455 314619177 314618193 0.000000e+00 1738
56 TraesCS1D01G009100 chr4D 98.184 991 11 4 7468 8455 6985208 6986194 0.000000e+00 1724
57 TraesCS1D01G009100 chr6D 98.579 985 9 3 7474 8455 455683851 455684833 0.000000e+00 1736
58 TraesCS1D01G009100 chr6D 98.379 987 12 2 7472 8455 38827932 38828917 0.000000e+00 1731
59 TraesCS1D01G009100 chr2D 98.286 992 13 2 7467 8455 625801672 625800682 0.000000e+00 1735
60 TraesCS1D01G009100 chr2D 98.477 985 12 1 7474 8455 636635820 636634836 0.000000e+00 1733
61 TraesCS1D01G009100 chr2D 98.283 990 13 2 7469 8455 5255646 5256634 0.000000e+00 1731
62 TraesCS1D01G009100 chr7D 98.379 987 10 4 7473 8455 186262651 186261667 0.000000e+00 1729


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1D01G009100 chr1D 4820227 4828681 8454 False 15614.000000 15614 100.000000 1 8455 1 chr1D.!!$F1 8454
1 TraesCS1D01G009100 chr1D 457023038 457024020 982 False 1736.000000 1736 98.579000 7474 8455 1 chr1D.!!$F2 981
2 TraesCS1D01G009100 chr1D 4821327 4826108 4781 False 890.375000 1291 82.649750 1101 5882 8 chr1D.!!$F4 4781
3 TraesCS1D01G009100 chr1D 4769080 4774908 5828 False 687.000000 977 84.611000 1234 7399 3 chr1D.!!$F3 6165
4 TraesCS1D01G009100 chr1D 90148764 90151955 3191 False 543.000000 867 80.930000 3302 7398 3 chr1D.!!$F5 4096
5 TraesCS1D01G009100 chr1D 10153606 10154339 733 True 407.000000 407 77.310000 6644 7352 1 chr1D.!!$R2 708
6 TraesCS1D01G009100 chr1B 22700348 22707647 7299 False 1843.444444 4846 87.374000 320 7462 9 chr1B.!!$F2 7142
7 TraesCS1D01G009100 chr1B 7988290 7995744 7454 False 1213.307692 4577 89.963000 1 7462 13 chr1B.!!$F1 7461
8 TraesCS1D01G009100 chr1B 144926621 144931939 5318 False 645.666667 1299 82.326333 1211 7398 3 chr1B.!!$F3 6187
9 TraesCS1D01G009100 chr1A 6317016 6324406 7390 False 1600.100000 4375 87.043900 248 7473 10 chr1A.!!$F3 7225
10 TraesCS1D01G009100 chr1A 86238590 86240202 1612 False 1314.000000 1314 81.675000 5769 7390 1 chr1A.!!$F2 1621
11 TraesCS1D01G009100 chr4D 314618193 314619177 984 True 1738.000000 1738 98.580000 7474 8455 1 chr4D.!!$R1 981
12 TraesCS1D01G009100 chr4D 6985208 6986194 986 False 1724.000000 1724 98.184000 7468 8455 1 chr4D.!!$F1 987
13 TraesCS1D01G009100 chr6D 455683851 455684833 982 False 1736.000000 1736 98.579000 7474 8455 1 chr6D.!!$F2 981
14 TraesCS1D01G009100 chr6D 38827932 38828917 985 False 1731.000000 1731 98.379000 7472 8455 1 chr6D.!!$F1 983
15 TraesCS1D01G009100 chr2D 625800682 625801672 990 True 1735.000000 1735 98.286000 7467 8455 1 chr2D.!!$R1 988
16 TraesCS1D01G009100 chr2D 636634836 636635820 984 True 1733.000000 1733 98.477000 7474 8455 1 chr2D.!!$R2 981
17 TraesCS1D01G009100 chr2D 5255646 5256634 988 False 1731.000000 1731 98.283000 7469 8455 1 chr2D.!!$F1 986
18 TraesCS1D01G009100 chr7D 186261667 186262651 984 True 1729.000000 1729 98.379000 7473 8455 1 chr7D.!!$R1 982

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
143 144 0.605589 GGATCCGATAGAGCACCCTG 59.394 60.000 0.00 0.00 39.76 4.45 F
1014 1049 3.244215 CCAGACTAGCAAGAAGACCACAA 60.244 47.826 0.00 0.00 0.00 3.33 F
1049 1084 2.535984 CTGTAGTAGCGAAAATGGCGAG 59.464 50.000 0.00 0.00 35.00 5.03 F
6423 7397 2.358898 GAGGCACAATATTGGCGTGATT 59.641 45.455 19.37 1.61 46.49 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1049 1084 4.516195 GACGAGGAGAAGCCGGGC 62.516 72.222 12.11 12.11 43.43 6.13 R
6167 6881 1.285641 CGTTTGCCGCCATGAAAGT 59.714 52.632 0.00 0.00 0.00 2.66 R
6423 7397 4.202253 CCAGGTGCTGCATGTAAGTCTATA 60.202 45.833 5.27 0.00 0.00 1.31 R
7570 12423 0.376152 TCGTAAGAGGCGCGACTAAG 59.624 55.000 18.29 0.89 45.01 2.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
50 51 1.154131 CTCGCTAGATCATCCGCCG 60.154 63.158 0.00 0.00 0.00 6.46
87 88 4.812476 CGGTGCTCGCGGATCCAA 62.812 66.667 13.41 0.00 0.00 3.53
132 133 4.241555 GGCCTGTGCGGATCCGAT 62.242 66.667 37.64 0.00 42.83 4.18
142 143 0.896019 CGGATCCGATAGAGCACCCT 60.896 60.000 30.62 0.00 42.83 4.34
143 144 0.605589 GGATCCGATAGAGCACCCTG 59.394 60.000 0.00 0.00 39.76 4.45
292 295 4.092091 GGCACAGTGTCTTCTCTATTTTCG 59.908 45.833 1.61 0.00 0.00 3.46
302 305 5.357314 TCTTCTCTATTTTCGTCACCGAGAT 59.643 40.000 0.00 0.00 45.24 2.75
360 363 6.793505 AACTGATACTACCTGGGAAACTAG 57.206 41.667 0.00 0.00 38.95 2.57
459 462 9.683069 ATCTTACTTGACAATTGACATTTTGAC 57.317 29.630 13.59 1.44 0.00 3.18
550 553 6.870971 AACCTACAAGCGATTCTACAAAAA 57.129 33.333 0.00 0.00 0.00 1.94
553 556 6.653320 ACCTACAAGCGATTCTACAAAAATCA 59.347 34.615 0.00 0.00 33.60 2.57
849 871 3.324846 CCAGCAGGCATATAGTTGGAGTA 59.675 47.826 0.00 0.00 35.91 2.59
1014 1049 3.244215 CCAGACTAGCAAGAAGACCACAA 60.244 47.826 0.00 0.00 0.00 3.33
1049 1084 2.535984 CTGTAGTAGCGAAAATGGCGAG 59.464 50.000 0.00 0.00 35.00 5.03
6423 7397 2.358898 GAGGCACAATATTGGCGTGATT 59.641 45.455 19.37 1.61 46.49 2.57
6804 11616 0.037232 ACGCTGTTAGGAAGCACTCC 60.037 55.000 0.00 0.00 45.81 3.85
6936 11748 1.670791 TCGAACCCAAGTTGGACAAC 58.329 50.000 24.06 7.08 40.96 3.32
6973 11785 5.336990 CAGAACATCGATTTCGTCAACAAAC 59.663 40.000 0.00 0.00 40.80 2.93
7506 12358 0.838987 AGGCCTTTAGTCCCGGTTCA 60.839 55.000 0.00 0.00 0.00 3.18
7728 12583 3.683885 CCCCCTAAACCTGGTTTCC 57.316 57.895 26.95 0.00 37.01 3.13
7971 12827 6.093495 ACAACTTCGAACAAGTTTCAATCTCA 59.907 34.615 0.00 0.00 38.32 3.27
8000 12856 6.277605 TGCATATAAATTTCTTCGTCCTCGA 58.722 36.000 0.00 0.00 44.66 4.04
8439 13298 1.861542 CGGCCCAACGCTTTGAATCA 61.862 55.000 4.19 0.00 37.74 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
19 20 0.398522 TAGCGAGGTGATCCATGGGT 60.399 55.000 13.02 3.70 35.89 4.51
68 69 4.933064 GGATCCGCGAGCACCGAG 62.933 72.222 8.23 0.00 41.76 4.63
87 88 1.258445 ATCTCTTGTCGGGTCGGCTT 61.258 55.000 0.00 0.00 30.55 4.35
132 133 1.623811 GTGTCCTTTCAGGGTGCTCTA 59.376 52.381 0.00 0.00 35.59 2.43
142 143 2.355363 CCGACGCGTGTCCTTTCA 60.355 61.111 20.70 0.00 42.37 2.69
143 144 3.774702 GCCGACGCGTGTCCTTTC 61.775 66.667 20.70 0.00 42.37 2.62
154 155 2.501881 CCGATTTTTGTAAAGCCGACG 58.498 47.619 0.00 0.00 0.00 5.12
204 205 8.596781 AGCTCTATATACTAATAGTTGTGGGG 57.403 38.462 0.00 0.00 32.31 4.96
292 295 2.753452 TGGAGAGTTGTATCTCGGTGAC 59.247 50.000 0.00 0.00 45.60 3.67
302 305 6.288294 GCCAATGTATATGTGGAGAGTTGTA 58.712 40.000 4.04 0.00 34.05 2.41
459 462 4.410400 GAAGTCGCCCCCACCCTG 62.410 72.222 0.00 0.00 0.00 4.45
513 516 3.917300 TGTAGGTTTTGGGTGGTTGATT 58.083 40.909 0.00 0.00 0.00 2.57
1049 1084 4.516195 GACGAGGAGAAGCCGGGC 62.516 72.222 12.11 12.11 43.43 6.13
6167 6881 1.285641 CGTTTGCCGCCATGAAAGT 59.714 52.632 0.00 0.00 0.00 2.66
6423 7397 4.202253 CCAGGTGCTGCATGTAAGTCTATA 60.202 45.833 5.27 0.00 0.00 1.31
6776 11588 0.036765 CCTAACAGCGTTGTAGCCCA 60.037 55.000 4.98 0.00 36.23 5.36
6804 11616 1.902508 ATGATCACATAGGCCGTAGGG 59.097 52.381 0.00 0.00 41.29 3.53
6936 11748 1.241165 TGTTCTGCTGCACATTGGAG 58.759 50.000 0.00 0.00 38.97 3.86
7400 12252 1.972872 AATATCTTGAGGCGCCAAGG 58.027 50.000 31.54 17.13 42.72 3.61
7506 12358 1.775385 CCGGGATTAATGGCCTTTGT 58.225 50.000 13.96 2.72 0.00 2.83
7570 12423 0.376152 TCGTAAGAGGCGCGACTAAG 59.624 55.000 18.29 0.89 45.01 2.18
7971 12827 8.157476 AGGACGAAGAAATTTATATGCATACCT 58.843 33.333 8.99 2.82 0.00 3.08


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.