Multiple sequence alignment - TraesCS1B01G481500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G481500 chr1B 100.000 3853 0 0 1 3853 689810222 689806370 0.000000e+00 7116
1 TraesCS1B01G481500 chr1B 98.542 3156 29 5 703 3853 689685909 689682766 0.000000e+00 5557
2 TraesCS1B01G481500 chr1B 95.959 2326 35 10 1240 3543 689491667 689489379 0.000000e+00 3720
3 TraesCS1B01G481500 chr1B 95.795 1974 57 12 1240 3199 689556688 689554727 0.000000e+00 3162
4 TraesCS1B01G481500 chr1B 97.023 1579 27 5 1240 2806 689505606 689504036 0.000000e+00 2638
5 TraesCS1B01G481500 chr1B 95.325 770 22 3 1 769 689493062 689492306 0.000000e+00 1210
6 TraesCS1B01G481500 chr1B 95.325 770 21 4 1 769 689507000 689506245 0.000000e+00 1208
7 TraesCS1B01G481500 chr1B 96.000 650 24 2 1 649 689699415 689698767 0.000000e+00 1055
8 TraesCS1B01G481500 chr1B 95.538 650 26 3 1 649 689570886 689570239 0.000000e+00 1037
9 TraesCS1B01G481500 chr1B 95.662 461 17 2 703 1160 689492254 689491794 0.000000e+00 737
10 TraesCS1B01G481500 chr1B 95.662 461 17 2 703 1160 689506193 689505733 0.000000e+00 737
11 TraesCS1B01G481500 chr1B 95.445 461 18 2 703 1160 689557275 689556815 0.000000e+00 732
12 TraesCS1B01G481500 chrUn 95.716 1844 41 9 1242 3072 306396761 306394943 0.000000e+00 2933
13 TraesCS1B01G481500 chrUn 96.082 1608 32 5 1603 3199 371634626 371636213 0.000000e+00 2591
14 TraesCS1B01G481500 chrUn 95.753 1554 47 12 1603 3153 391042968 391044505 0.000000e+00 2486
15 TraesCS1B01G481500 chrUn 94.226 1143 42 13 2719 3850 308753333 308754462 0.000000e+00 1724
16 TraesCS1B01G481500 chrUn 96.644 864 22 7 2682 3543 393512209 393511351 0.000000e+00 1428
17 TraesCS1B01G481500 chrUn 96.412 864 24 7 2682 3543 439928072 439928930 0.000000e+00 1417
18 TraesCS1B01G481500 chrUn 95.325 770 22 3 1 769 403563787 403564543 0.000000e+00 1210
19 TraesCS1B01G481500 chrUn 95.065 770 23 4 1 769 339962126 339962881 0.000000e+00 1197
20 TraesCS1B01G481500 chrUn 98.204 668 12 0 1495 2162 470694217 470694884 0.000000e+00 1168
21 TraesCS1B01G481500 chrUn 93.726 781 23 3 2429 3199 455436247 455435483 0.000000e+00 1147
22 TraesCS1B01G481500 chrUn 95.538 650 27 2 1 649 450682421 450681773 0.000000e+00 1038
23 TraesCS1B01G481500 chrUn 99.127 573 5 0 1490 2062 403564557 403565129 0.000000e+00 1031
24 TraesCS1B01G481500 chrUn 96.654 538 7 2 1240 1766 440306996 440306459 0.000000e+00 883
25 TraesCS1B01G481500 chrUn 93.966 580 21 3 1 579 435663328 435663894 0.000000e+00 865
26 TraesCS1B01G481500 chrUn 96.381 525 7 2 1254 1766 339963085 339963609 0.000000e+00 854
27 TraesCS1B01G481500 chrUn 94.106 526 17 6 1 525 346623563 346623051 0.000000e+00 787
28 TraesCS1B01G481500 chrUn 97.204 465 12 1 185 649 284661194 284661657 0.000000e+00 785
29 TraesCS1B01G481500 chrUn 97.204 465 12 1 185 649 303597947 303597484 0.000000e+00 785
30 TraesCS1B01G481500 chrUn 93.680 538 6 3 1240 1766 411719041 411719561 0.000000e+00 780
31 TraesCS1B01G481500 chrUn 92.692 520 32 6 2682 3199 260327527 260328042 0.000000e+00 745
32 TraesCS1B01G481500 chrUn 95.887 462 15 3 703 1160 457236976 457237437 0.000000e+00 745
33 TraesCS1B01G481500 chrUn 95.652 460 18 1 703 1160 306397349 306396890 0.000000e+00 737
34 TraesCS1B01G481500 chrUn 95.662 461 17 2 703 1160 411718454 411718914 0.000000e+00 737
35 TraesCS1B01G481500 chrUn 94.444 432 21 2 732 1160 440307554 440307123 0.000000e+00 662
36 TraesCS1B01G481500 chrUn 90.938 320 11 6 1170 1478 457237558 457237870 7.700000e-112 414
37 TraesCS1B01G481500 chrUn 97.576 165 3 1 605 769 411718239 411718402 8.150000e-72 281
38 TraesCS1B01G481500 chrUn 97.368 152 4 0 703 854 339962933 339963084 3.820000e-65 259
39 TraesCS1B01G481500 chr7D 87.361 269 34 0 3580 3848 35013629 35013361 3.740000e-80 309


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G481500 chr1B 689806370 689810222 3852 True 7116.000000 7116 100.000000 1 3853 1 chr1B.!!$R4 3852
1 TraesCS1B01G481500 chr1B 689682766 689685909 3143 True 5557.000000 5557 98.542000 703 3853 1 chr1B.!!$R2 3150
2 TraesCS1B01G481500 chr1B 689554727 689557275 2548 True 1947.000000 3162 95.620000 703 3199 2 chr1B.!!$R7 2496
3 TraesCS1B01G481500 chr1B 689489379 689493062 3683 True 1889.000000 3720 95.648667 1 3543 3 chr1B.!!$R5 3542
4 TraesCS1B01G481500 chr1B 689504036 689507000 2964 True 1527.666667 2638 96.003333 1 2806 3 chr1B.!!$R6 2805
5 TraesCS1B01G481500 chr1B 689698767 689699415 648 True 1055.000000 1055 96.000000 1 649 1 chr1B.!!$R3 648
6 TraesCS1B01G481500 chr1B 689570239 689570886 647 True 1037.000000 1037 95.538000 1 649 1 chr1B.!!$R1 648
7 TraesCS1B01G481500 chrUn 371634626 371636213 1587 False 2591.000000 2591 96.082000 1603 3199 1 chrUn.!!$F4 1596
8 TraesCS1B01G481500 chrUn 391042968 391044505 1537 False 2486.000000 2486 95.753000 1603 3153 1 chrUn.!!$F5 1550
9 TraesCS1B01G481500 chrUn 306394943 306397349 2406 True 1835.000000 2933 95.684000 703 3072 2 chrUn.!!$R6 2369
10 TraesCS1B01G481500 chrUn 308753333 308754462 1129 False 1724.000000 1724 94.226000 2719 3850 1 chrUn.!!$F3 1131
11 TraesCS1B01G481500 chrUn 393511351 393512209 858 True 1428.000000 1428 96.644000 2682 3543 1 chrUn.!!$R3 861
12 TraesCS1B01G481500 chrUn 439928072 439928930 858 False 1417.000000 1417 96.412000 2682 3543 1 chrUn.!!$F7 861
13 TraesCS1B01G481500 chrUn 470694217 470694884 667 False 1168.000000 1168 98.204000 1495 2162 1 chrUn.!!$F8 667
14 TraesCS1B01G481500 chrUn 455435483 455436247 764 True 1147.000000 1147 93.726000 2429 3199 1 chrUn.!!$R5 770
15 TraesCS1B01G481500 chrUn 403563787 403565129 1342 False 1120.500000 1210 97.226000 1 2062 2 chrUn.!!$F10 2061
16 TraesCS1B01G481500 chrUn 450681773 450682421 648 True 1038.000000 1038 95.538000 1 649 1 chrUn.!!$R4 648
17 TraesCS1B01G481500 chrUn 435663328 435663894 566 False 865.000000 865 93.966000 1 579 1 chrUn.!!$F6 578
18 TraesCS1B01G481500 chrUn 346623051 346623563 512 True 787.000000 787 94.106000 1 525 1 chrUn.!!$R2 524
19 TraesCS1B01G481500 chrUn 440306459 440307554 1095 True 772.500000 883 95.549000 732 1766 2 chrUn.!!$R7 1034
20 TraesCS1B01G481500 chrUn 339962126 339963609 1483 False 770.000000 1197 96.271333 1 1766 3 chrUn.!!$F9 1765
21 TraesCS1B01G481500 chrUn 260327527 260328042 515 False 745.000000 745 92.692000 2682 3199 1 chrUn.!!$F1 517
22 TraesCS1B01G481500 chrUn 411718239 411719561 1322 False 599.333333 780 95.639333 605 1766 3 chrUn.!!$F11 1161
23 TraesCS1B01G481500 chrUn 457236976 457237870 894 False 579.500000 745 93.412500 703 1478 2 chrUn.!!$F12 775

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
889 1034 1.108727 CACTGCCAAGCCAAACCAGA 61.109 55.0 0.0 0.0 0.0 3.86 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3454 3755 2.43126 CCGGTTGTACACGGGTCG 60.431 66.667 15.31 0.0 46.08 4.79 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
81 82 6.692681 CACAAATTGAACGGAAGGCATTATAG 59.307 38.462 0.00 0.00 0.00 1.31
87 88 6.880484 TGAACGGAAGGCATTATAGAAGTTA 58.120 36.000 0.00 0.00 0.00 2.24
92 93 7.827729 ACGGAAGGCATTATAGAAGTTAAACTT 59.172 33.333 0.00 0.00 41.95 2.66
152 154 4.457257 GCATAGCTCCCAATTCCATTACTC 59.543 45.833 0.00 0.00 0.00 2.59
162 164 6.095440 CCCAATTCCATTACTCGAATGAAACT 59.905 38.462 0.00 0.00 46.94 2.66
229 231 4.756642 CCAGCAAGACACTATTGAACAGAA 59.243 41.667 0.00 0.00 0.00 3.02
495 521 1.208052 CACTTGTCCGGATCCAGTCAT 59.792 52.381 7.81 0.00 0.00 3.06
669 696 6.874134 TCTTCTTCTTCTATTCCAAGGTTTCG 59.126 38.462 0.00 0.00 0.00 3.46
784 929 2.010817 CTTTGCGTGGCACGAAAGC 61.011 57.895 40.94 24.26 46.05 3.51
889 1034 1.108727 CACTGCCAAGCCAAACCAGA 61.109 55.000 0.00 0.00 0.00 3.86
990 1135 3.026694 GGGGACACACGGTAGTTACTAT 58.973 50.000 0.00 0.00 0.00 2.12
1063 1208 0.878961 GGTCGAAGTGCACGGACTTT 60.879 55.000 26.44 12.03 36.27 2.66
1065 1210 2.129607 GTCGAAGTGCACGGACTTTAA 58.870 47.619 22.92 0.00 36.27 1.52
1069 1214 3.242478 CGAAGTGCACGGACTTTAAAACA 60.242 43.478 12.01 0.00 36.27 2.83
1086 1231 0.753848 ACAACGGGTCCAAACAAGGG 60.754 55.000 0.00 0.00 0.00 3.95
1386 1674 6.998258 CGTTTTCTCTACGTAAGGAAGAAA 57.002 37.500 13.66 13.66 46.39 2.52
1480 1768 0.882474 CGAACGAGACCAAGACCTCT 59.118 55.000 0.00 0.00 0.00 3.69
3454 3755 2.098298 CATGCGCGTGTACAAGCC 59.902 61.111 24.96 18.30 32.09 4.35
3688 3997 4.403137 CCCGCCATGTTGCACACG 62.403 66.667 0.00 0.00 0.00 4.49
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
41 42 7.490962 TCAATTTGTGTCGTCTCATAAAAGT 57.509 32.000 0.00 0.0 33.60 2.66
152 154 8.879342 ATCCTGTTTATCTCTAGTTTCATTCG 57.121 34.615 0.00 0.0 0.00 3.34
495 521 6.821388 AGAAGAGTAGAAGAAGCAACAGAAA 58.179 36.000 0.00 0.0 0.00 2.52
536 562 3.221771 AGCAAACATGAGTGCCAAGTTA 58.778 40.909 17.79 0.0 41.88 2.24
669 696 3.728076 TCTGGATAAGTGGCGTATGAC 57.272 47.619 0.00 0.0 0.00 3.06
747 892 3.204597 AGCAACGAACGAACAAAAACA 57.795 38.095 0.14 0.0 0.00 2.83
784 929 0.966920 ACCCGAATAGCATCCCTACG 59.033 55.000 0.00 0.0 0.00 3.51
867 1012 2.123338 TTTGGCTTGGCAGTGGCT 60.123 55.556 18.53 0.0 40.87 4.75
889 1034 1.945394 CTTGACAAGTGTTGCTCAGCT 59.055 47.619 7.05 0.0 0.00 4.24
990 1135 2.604079 TGGTCGGCGGGTTAGGAA 60.604 61.111 7.21 0.0 0.00 3.36
1063 1208 3.130693 CCTTGTTTGGACCCGTTGTTTTA 59.869 43.478 0.00 0.0 0.00 1.52
1065 1210 1.478916 CCTTGTTTGGACCCGTTGTTT 59.521 47.619 0.00 0.0 0.00 2.83
1069 1214 0.032912 AACCCTTGTTTGGACCCGTT 60.033 50.000 0.00 0.0 0.00 4.44
1094 1243 4.080526 GGGGCTAAACAAGAGATGACCTAA 60.081 45.833 0.00 0.0 0.00 2.69
1386 1674 0.689623 AGCTGCTACCTGCTTCTTGT 59.310 50.000 0.00 0.0 42.73 3.16
1480 1768 1.877576 AACTCGTCGCTGCTCATGGA 61.878 55.000 0.00 0.0 0.00 3.41
3454 3755 2.431260 CCGGTTGTACACGGGTCG 60.431 66.667 15.31 0.0 46.08 4.79


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.