Multiple sequence alignment - TraesCS1B01G481300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G481300 chr1B 100.000 3182 0 0 1 3182 689557433 689554252 0.000000e+00 5877.0
1 TraesCS1B01G481300 chr1B 98.505 2608 22 1 100 2707 689492313 689489723 0.000000e+00 4584.0
2 TraesCS1B01G481300 chr1B 99.065 2247 21 0 100 2346 689506252 689504006 0.000000e+00 4034.0
3 TraesCS1B01G481300 chr1B 95.947 1974 55 13 746 2707 689685379 689683419 0.000000e+00 3179.0
4 TraesCS1B01G481300 chr1B 95.795 1974 57 12 746 2707 689808983 689807024 0.000000e+00 3162.0
5 TraesCS1B01G481300 chr1B 96.935 620 7 2 1 619 689686067 689685459 0.000000e+00 1029.0
6 TraesCS1B01G481300 chr1B 95.445 461 18 2 159 619 689809520 689809063 0.000000e+00 732.0
7 TraesCS1B01G481300 chr1B 87.293 181 7 7 3006 3170 689679912 689679732 3.240000e-45 193.0
8 TraesCS1B01G481300 chr1B 87.500 176 6 9 3011 3170 689803529 689803354 4.190000e-44 189.0
9 TraesCS1B01G481300 chr1B 98.000 50 0 1 1 49 41968607 41968558 5.660000e-13 86.1
10 TraesCS1B01G481300 chr1B 95.556 45 2 0 1 45 46961219 46961263 4.400000e-09 73.1
11 TraesCS1B01G481300 chrUn 97.137 2585 49 10 1 2580 306397507 306394943 0.000000e+00 4340.0
12 TraesCS1B01G481300 chrUn 99.109 1796 16 0 1120 2915 371634626 371636421 0.000000e+00 3229.0
13 TraesCS1B01G481300 chrUn 99.092 1542 10 3 1120 2661 391042968 391044505 0.000000e+00 2767.0
14 TraesCS1B01G481300 chrUn 97.551 1184 12 1 100 1283 411718395 411719561 0.000000e+00 2010.0
15 TraesCS1B01G481300 chrUn 98.905 1096 12 0 188 1283 440307554 440306459 0.000000e+00 1958.0
16 TraesCS1B01G481300 chrUn 99.383 973 6 0 1943 2915 455436247 455435275 0.000000e+00 1764.0
17 TraesCS1B01G481300 chrUn 98.952 668 7 0 1012 1679 470694217 470694884 0.000000e+00 1195.0
18 TraesCS1B01G481300 chrUn 99.076 649 6 0 2192 2840 260327527 260328175 0.000000e+00 1166.0
19 TraesCS1B01G481300 chrUn 99.825 573 1 0 1007 1579 403564557 403565129 0.000000e+00 1053.0
20 TraesCS1B01G481300 chrUn 96.523 604 20 1 100 702 457236917 457237520 0.000000e+00 998.0
21 TraesCS1B01G481300 chrUn 99.429 525 2 1 760 1283 339963085 339963609 0.000000e+00 952.0
22 TraesCS1B01G481300 chrUn 97.093 516 15 0 2192 2707 393512209 393511694 0.000000e+00 870.0
23 TraesCS1B01G481300 chrUn 97.093 516 15 0 2192 2707 439928072 439928587 0.000000e+00 870.0
24 TraesCS1B01G481300 chrUn 99.374 479 3 0 2229 2707 308753333 308753811 0.000000e+00 869.0
25 TraesCS1B01G481300 chrUn 92.295 610 12 12 2577 3182 306394578 306394000 0.000000e+00 833.0
26 TraesCS1B01G481300 chrUn 98.945 379 2 1 2806 3182 399661571 399661949 0.000000e+00 676.0
27 TraesCS1B01G481300 chrUn 97.098 379 5 3 2806 3182 399034650 399035024 4.480000e-178 634.0
28 TraesCS1B01G481300 chrUn 97.098 379 5 3 2806 3182 409335399 409335773 4.480000e-178 634.0
29 TraesCS1B01G481300 chrUn 99.200 250 2 0 746 995 457237621 457237870 4.840000e-123 451.0
30 TraesCS1B01G481300 chrUn 98.578 211 3 0 100 310 339962874 339963084 1.080000e-99 374.0
31 TraesCS1B01G481300 chrUn 98.901 182 2 0 44 225 339962759 339962940 3.060000e-85 326.0
32 TraesCS1B01G481300 chrUn 99.425 174 1 0 3009 3182 260328851 260329024 1.840000e-82 316.0
33 TraesCS1B01G481300 chrUn 97.802 182 4 0 44 225 411718280 411718461 6.630000e-82 315.0
34 TraesCS1B01G481300 chrUn 90.173 173 6 7 3006 3167 283524105 283524277 6.910000e-52 215.0
35 TraesCS1B01G481300 chrUn 97.297 111 3 0 2806 2916 260328741 260328851 4.190000e-44 189.0
36 TraesCS1B01G481300 chrUn 100.000 99 0 0 3084 3182 348858488 348858390 1.950000e-42 183.0
37 TraesCS1B01G481300 chrUn 100.000 99 0 0 3084 3182 370466952 370467050 1.950000e-42 183.0
38 TraesCS1B01G481300 chr4D 96.703 91 2 1 2717 2807 484449506 484449595 1.980000e-32 150.0
39 TraesCS1B01G481300 chr7D 95.652 92 3 1 2717 2808 602283410 602283500 2.560000e-31 147.0
40 TraesCS1B01G481300 chr2D 94.681 94 5 0 2717 2810 142521528 142521435 2.560000e-31 147.0
41 TraesCS1B01G481300 chr3A 91.919 99 6 2 2718 2815 441846069 441845972 1.540000e-28 137.0
42 TraesCS1B01G481300 chr7A 92.553 94 5 2 2717 2810 516879946 516879855 1.990000e-27 134.0
43 TraesCS1B01G481300 chr5B 98.113 53 0 1 1 53 702101392 702101341 1.220000e-14 91.6
44 TraesCS1B01G481300 chr7B 100.000 48 0 0 1 48 721335445 721335398 4.370000e-14 89.8
45 TraesCS1B01G481300 chr6B 96.078 51 2 0 1 51 132950884 132950834 2.030000e-12 84.2
46 TraesCS1B01G481300 chr4B 94.545 55 2 1 1 55 380121654 380121707 2.030000e-12 84.2
47 TraesCS1B01G481300 chr2B 92.982 57 2 2 1 55 650024532 650024476 7.320000e-12 82.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G481300 chr1B 689554252 689557433 3181 True 5877.000000 5877 100.000000 1 3182 1 chr1B.!!$R4 3181
1 TraesCS1B01G481300 chr1B 689489723 689492313 2590 True 4584.000000 4584 98.505000 100 2707 1 chr1B.!!$R2 2607
2 TraesCS1B01G481300 chr1B 689504006 689506252 2246 True 4034.000000 4034 99.065000 100 2346 1 chr1B.!!$R3 2246
3 TraesCS1B01G481300 chr1B 689679732 689686067 6335 True 1467.000000 3179 93.391667 1 3170 3 chr1B.!!$R5 3169
4 TraesCS1B01G481300 chr1B 689803354 689809520 6166 True 1361.000000 3162 92.913333 159 3170 3 chr1B.!!$R6 3011
5 TraesCS1B01G481300 chrUn 371634626 371636421 1795 False 3229.000000 3229 99.109000 1120 2915 1 chrUn.!!$F4 1795
6 TraesCS1B01G481300 chrUn 391042968 391044505 1537 False 2767.000000 2767 99.092000 1120 2661 1 chrUn.!!$F5 1541
7 TraesCS1B01G481300 chrUn 306394000 306397507 3507 True 2586.500000 4340 94.716000 1 3182 2 chrUn.!!$R5 3181
8 TraesCS1B01G481300 chrUn 440306459 440307554 1095 True 1958.000000 1958 98.905000 188 1283 1 chrUn.!!$R3 1095
9 TraesCS1B01G481300 chrUn 455435275 455436247 972 True 1764.000000 1764 99.383000 1943 2915 1 chrUn.!!$R4 972
10 TraesCS1B01G481300 chrUn 470694217 470694884 667 False 1195.000000 1195 98.952000 1012 1679 1 chrUn.!!$F11 667
11 TraesCS1B01G481300 chrUn 411718280 411719561 1281 False 1162.500000 2010 97.676500 44 1283 2 chrUn.!!$F14 1239
12 TraesCS1B01G481300 chrUn 403564557 403565129 572 False 1053.000000 1053 99.825000 1007 1579 1 chrUn.!!$F8 572
13 TraesCS1B01G481300 chrUn 393511694 393512209 515 True 870.000000 870 97.093000 2192 2707 1 chrUn.!!$R2 515
14 TraesCS1B01G481300 chrUn 439928072 439928587 515 False 870.000000 870 97.093000 2192 2707 1 chrUn.!!$F10 515
15 TraesCS1B01G481300 chrUn 457236917 457237870 953 False 724.500000 998 97.861500 100 995 2 chrUn.!!$F15 895
16 TraesCS1B01G481300 chrUn 260327527 260329024 1497 False 557.000000 1166 98.599333 2192 3182 3 chrUn.!!$F12 990
17 TraesCS1B01G481300 chrUn 339962759 339963609 850 False 550.666667 952 98.969333 44 1283 3 chrUn.!!$F13 1239

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
764 964 2.101750 GGAGGAGGCTACAACTAGAAGC 59.898 54.545 0.00 0.0 35.47 3.86 F
1746 1947 2.012937 TCGTCGCCGGAAATATGTTT 57.987 45.000 5.05 0.0 33.95 2.83 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1579 1780 0.398318 AGCGAGCTTTTCACTTCCCT 59.602 50.0 0.00 0.0 0.00 4.20 R
2590 3178 2.101582 ACTCATTGAGACCGGACTATGC 59.898 50.0 20.33 0.0 33.32 3.14 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
719 919 7.703058 AATTGTTTACTAAGGTGAATGGGAG 57.297 36.000 0.00 0.0 0.00 4.30
764 964 2.101750 GGAGGAGGCTACAACTAGAAGC 59.898 54.545 0.00 0.0 35.47 3.86
1746 1947 2.012937 TCGTCGCCGGAAATATGTTT 57.987 45.000 5.05 0.0 33.95 2.83
1908 2113 2.096218 GCATGACTGGAAACACGAAGAC 60.096 50.000 0.00 0.0 35.60 3.01
2141 2346 2.096013 TCAGCGACTACAAGATCACTCG 59.904 50.000 0.00 0.0 0.00 4.18
2949 7028 2.279918 AACACGCGGTCTGGTCAC 60.280 61.111 12.47 0.0 0.00 3.67
3082 7532 9.431690 TTGGATTGGATTGGATTGTTATTATCA 57.568 29.630 0.00 0.0 0.00 2.15
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
154 214 5.639931 AGAAGAATAGAAGAAGCAACGAACC 59.360 40.000 0.00 0.0 0.00 3.62
434 553 4.526970 CGGGTTAGGAGTAGTAACTACCA 58.473 47.826 0.00 0.0 37.25 3.25
764 964 1.535462 CGGCTTGGTTTGAGGTTACTG 59.465 52.381 0.00 0.0 0.00 2.74
1579 1780 0.398318 AGCGAGCTTTTCACTTCCCT 59.602 50.000 0.00 0.0 0.00 4.20
1746 1947 1.897423 CGCAGGTGGGACATACTCA 59.103 57.895 0.00 0.0 44.52 3.41
2141 2346 5.520376 AATTGATCGAATCCCATTGGTTC 57.480 39.130 1.20 0.0 0.00 3.62
2590 3178 2.101582 ACTCATTGAGACCGGACTATGC 59.898 50.000 20.33 0.0 33.32 3.14
2949 7028 3.633094 CTGTGGGTCACGAGGAGCG 62.633 68.421 0.00 0.0 45.03 5.03
2993 7072 2.320745 TCCTACTGTCTGCATGCATG 57.679 50.000 22.97 22.7 0.00 4.06


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.