Multiple sequence alignment - TraesCS1B01G477600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G477600 chr1B 100.000 2591 0 0 1 2591 685739844 685742434 0.000000e+00 4785.0
1 TraesCS1B01G477600 chr1B 98.160 2120 28 5 475 2591 685778949 685781060 0.000000e+00 3688.0
2 TraesCS1B01G477600 chr1B 97.782 2119 37 4 475 2591 685825830 685827940 0.000000e+00 3644.0
3 TraesCS1B01G477600 chr1B 97.688 2119 38 5 475 2591 685893217 685895326 0.000000e+00 3631.0
4 TraesCS1B01G477600 chr1B 99.251 2002 11 1 1 2002 685776957 685778954 0.000000e+00 3611.0
5 TraesCS1B01G477600 chr1B 98.455 2006 20 6 1 2002 685891224 685893222 0.000000e+00 3522.0
6 TraesCS1B01G477600 chr1B 99.120 1818 12 1 1 1818 685823763 685825576 0.000000e+00 3265.0
7 TraesCS1B01G477600 chr1B 99.135 1503 9 1 1 1503 685862464 685863962 0.000000e+00 2700.0
8 TraesCS1B01G477600 chr1B 100.000 43 0 0 375 417 685740155 685740197 2.140000e-11 80.5
9 TraesCS1B01G477600 chrUn 98.160 2120 28 5 475 2591 303750608 303752719 0.000000e+00 3688.0
10 TraesCS1B01G477600 chrUn 99.249 1731 9 1 272 2002 303748887 303750613 0.000000e+00 3121.0
11 TraesCS1B01G477600 chrUn 97.795 1814 30 3 475 2286 352072954 352071149 0.000000e+00 3120.0
12 TraesCS1B01G477600 chrUn 99.135 1503 9 1 1 1503 308714093 308712595 0.000000e+00 2700.0
13 TraesCS1B01G477600 chrUn 98.168 1528 18 4 761 2286 392571016 392569497 0.000000e+00 2658.0
14 TraesCS1B01G477600 chrUn 97.514 885 13 2 475 1358 400351868 400352744 0.000000e+00 1504.0
15 TraesCS1B01G477600 chrUn 100.000 43 0 0 375 417 303748927 303748969 2.140000e-11 80.5
16 TraesCS1B01G477600 chrUn 100.000 43 0 0 375 417 308713782 308713740 2.140000e-11 80.5
17 TraesCS1B01G477600 chr7D 95.745 470 20 0 2122 2591 519290298 519289829 0.000000e+00 758.0
18 TraesCS1B01G477600 chr6D 95.708 466 20 0 2126 2591 87376805 87377270 0.000000e+00 750.0
19 TraesCS1B01G477600 chr5D 92.979 470 27 3 2122 2591 353785804 353786267 0.000000e+00 680.0
20 TraesCS1B01G477600 chr4A 92.553 470 34 1 2122 2591 612612744 612613212 0.000000e+00 673.0
21 TraesCS1B01G477600 chr3A 90.426 470 43 2 2122 2591 12728068 12727601 3.660000e-173 617.0
22 TraesCS1B01G477600 chr2D 83.495 206 21 9 2 201 218610741 218610543 2.050000e-41 180.0
23 TraesCS1B01G477600 chr2D 79.688 256 37 12 2 248 642895304 642895553 1.230000e-38 171.0
24 TraesCS1B01G477600 chr2D 78.846 260 40 13 1 254 5368108 5367858 7.420000e-36 161.0
25 TraesCS1B01G477600 chr7A 80.804 224 33 8 3 219 61924105 61923885 1.590000e-37 167.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G477600 chr1B 685739844 685742434 2590 False 2432.75 4785 100.000000 1 2591 2 chr1B.!!$F2 2590
1 TraesCS1B01G477600 chr1B 685776957 685781060 4103 False 3649.50 3688 98.705500 1 2591 2 chr1B.!!$F3 2590
2 TraesCS1B01G477600 chr1B 685891224 685895326 4102 False 3576.50 3631 98.071500 1 2591 2 chr1B.!!$F5 2590
3 TraesCS1B01G477600 chr1B 685823763 685827940 4177 False 3454.50 3644 98.451000 1 2591 2 chr1B.!!$F4 2590
4 TraesCS1B01G477600 chr1B 685862464 685863962 1498 False 2700.00 2700 99.135000 1 1503 1 chr1B.!!$F1 1502
5 TraesCS1B01G477600 chrUn 352071149 352072954 1805 True 3120.00 3120 97.795000 475 2286 1 chrUn.!!$R1 1811
6 TraesCS1B01G477600 chrUn 392569497 392571016 1519 True 2658.00 2658 98.168000 761 2286 1 chrUn.!!$R2 1525
7 TraesCS1B01G477600 chrUn 303748887 303752719 3832 False 2296.50 3688 99.136333 272 2591 3 chrUn.!!$F2 2319
8 TraesCS1B01G477600 chrUn 400351868 400352744 876 False 1504.00 1504 97.514000 475 1358 1 chrUn.!!$F1 883
9 TraesCS1B01G477600 chrUn 308712595 308714093 1498 True 1390.25 2700 99.567500 1 1503 2 chrUn.!!$R3 1502

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
897 900 2.092375 GGGGAACACCAGCTAGCTAATT 60.092 50.0 18.86 9.2 42.91 1.4 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1724 3317 0.729116 CATTGGACCAACAGCTAGCG 59.271 55.0 9.67 7.05 0.0 4.26 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
286 287 8.798640 TTAAAAAGCGCGCAATAAATAAAATG 57.201 26.923 35.10 0.0 0.00 2.32
897 900 2.092375 GGGGAACACCAGCTAGCTAATT 60.092 50.000 18.86 9.2 42.91 1.40
1066 1069 3.832492 TCATCGCCGTCGCCATCA 61.832 61.111 0.00 0.0 35.26 3.07
1672 3265 1.281419 TGGAATTGGGAGCGGAGTAA 58.719 50.000 0.00 0.0 0.00 2.24
1841 3434 2.102578 ACATTTGCTGCCATAACCTCC 58.897 47.619 0.00 0.0 0.00 4.30
2402 3997 2.021068 CTCCGCCTCGACATCACCAT 62.021 60.000 0.00 0.0 0.00 3.55
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
461 462 5.689383 TGATTTTCTTGTTCTTCGAAGGG 57.311 39.130 24.37 10.17 0.00 3.95
897 900 0.947660 CACTTGCAGCGAGAGAGCAA 60.948 55.000 17.30 0.00 46.36 3.91
1066 1069 3.560251 AACTGCAGGGGCGACAGT 61.560 61.111 19.93 0.00 46.27 3.55
1672 3265 3.129988 GCATAAAGGCAACATGAGCTTCT 59.870 43.478 0.00 0.00 41.41 2.85
1724 3317 0.729116 CATTGGACCAACAGCTAGCG 59.271 55.000 9.67 7.05 0.00 4.26
2072 3667 1.746220 AGAAACTCGAGCTAGCACGAT 59.254 47.619 32.20 20.71 38.25 3.73


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.