Multiple sequence alignment - TraesCS1B01G458700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G458700 chr1B 100.000 2573 0 0 1 2573 672558780 672556208 0 4752
1 TraesCS1B01G458700 chr1B 99.414 512 3 0 2062 2573 338891438 338891949 0 929
2 TraesCS1B01G458700 chr5A 98.597 2067 25 2 1 2063 19253497 19251431 0 3653
3 TraesCS1B01G458700 chr7A 98.499 2065 28 3 1 2063 120845800 120843737 0 3639
4 TraesCS1B01G458700 chr7A 98.162 2067 32 4 1 2063 60274666 60276730 0 3602
5 TraesCS1B01G458700 chr7B 98.452 2067 28 2 1 2063 716843188 716841122 0 3637
6 TraesCS1B01G458700 chr7B 98.452 2067 28 2 1 2063 716883429 716881363 0 3637
7 TraesCS1B01G458700 chr7B 98.210 2067 33 2 1 2063 742984796 742986862 0 3609
8 TraesCS1B01G458700 chr7B 99.220 513 3 1 2062 2573 698138785 698139297 0 924
9 TraesCS1B01G458700 chr7D 98.307 2067 27 3 1 2063 203495361 203497423 0 3616
10 TraesCS1B01G458700 chr7D 98.210 2067 29 3 1 2063 381978400 381976338 0 3605
11 TraesCS1B01G458700 chr6D 98.307 2067 27 3 1 2063 124512886 124514948 0 3616
12 TraesCS1B01G458700 chr3B 99.414 512 3 0 2062 2573 92260483 92260994 0 929
13 TraesCS1B01G458700 chr2A 99.220 513 2 2 2062 2573 735131548 735132059 0 924
14 TraesCS1B01G458700 chr2A 99.025 513 4 1 2062 2573 605914252 605913740 0 918
15 TraesCS1B01G458700 chrUn 99.027 514 3 1 2062 2573 223708311 223707798 0 920
16 TraesCS1B01G458700 chrUn 99.029 515 2 1 2062 2573 246709170 246709684 0 920
17 TraesCS1B01G458700 chrUn 98.833 514 4 1 2062 2573 266189458 266188945 0 915
18 TraesCS1B01G458700 chr5B 98.833 514 4 1 2062 2573 695887093 695886580 0 915


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G458700 chr1B 672556208 672558780 2572 True 4752 4752 100.000 1 2573 1 chr1B.!!$R1 2572
1 TraesCS1B01G458700 chr1B 338891438 338891949 511 False 929 929 99.414 2062 2573 1 chr1B.!!$F1 511
2 TraesCS1B01G458700 chr5A 19251431 19253497 2066 True 3653 3653 98.597 1 2063 1 chr5A.!!$R1 2062
3 TraesCS1B01G458700 chr7A 120843737 120845800 2063 True 3639 3639 98.499 1 2063 1 chr7A.!!$R1 2062
4 TraesCS1B01G458700 chr7A 60274666 60276730 2064 False 3602 3602 98.162 1 2063 1 chr7A.!!$F1 2062
5 TraesCS1B01G458700 chr7B 716841122 716843188 2066 True 3637 3637 98.452 1 2063 1 chr7B.!!$R1 2062
6 TraesCS1B01G458700 chr7B 716881363 716883429 2066 True 3637 3637 98.452 1 2063 1 chr7B.!!$R2 2062
7 TraesCS1B01G458700 chr7B 742984796 742986862 2066 False 3609 3609 98.210 1 2063 1 chr7B.!!$F2 2062
8 TraesCS1B01G458700 chr7B 698138785 698139297 512 False 924 924 99.220 2062 2573 1 chr7B.!!$F1 511
9 TraesCS1B01G458700 chr7D 203495361 203497423 2062 False 3616 3616 98.307 1 2063 1 chr7D.!!$F1 2062
10 TraesCS1B01G458700 chr7D 381976338 381978400 2062 True 3605 3605 98.210 1 2063 1 chr7D.!!$R1 2062
11 TraesCS1B01G458700 chr6D 124512886 124514948 2062 False 3616 3616 98.307 1 2063 1 chr6D.!!$F1 2062
12 TraesCS1B01G458700 chr3B 92260483 92260994 511 False 929 929 99.414 2062 2573 1 chr3B.!!$F1 511
13 TraesCS1B01G458700 chr2A 735131548 735132059 511 False 924 924 99.220 2062 2573 1 chr2A.!!$F1 511
14 TraesCS1B01G458700 chr2A 605913740 605914252 512 True 918 918 99.025 2062 2573 1 chr2A.!!$R1 511
15 TraesCS1B01G458700 chrUn 223707798 223708311 513 True 920 920 99.027 2062 2573 1 chrUn.!!$R1 511
16 TraesCS1B01G458700 chrUn 246709170 246709684 514 False 920 920 99.029 2062 2573 1 chrUn.!!$F1 511
17 TraesCS1B01G458700 chrUn 266188945 266189458 513 True 915 915 98.833 2062 2573 1 chrUn.!!$R2 511
18 TraesCS1B01G458700 chr5B 695886580 695887093 513 True 915 915 98.833 2062 2573 1 chr5B.!!$R1 511

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
767 770 2.031683 GCGGATTCGGAATTGTAACCAG 59.968 50.0 4.47 0.22 36.79 4.0 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2076 2082 2.206576 AAGGATTTCCAGTCACAGCC 57.793 50.0 0.0 0.0 38.89 4.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
99 100 2.731976 CCTTGCTTGTTCTCGTACAGTC 59.268 50.000 0.00 0.00 0.00 3.51
536 539 7.067372 TCGTTCCAGAACTCCTTAATAATACGA 59.933 37.037 8.77 0.00 39.08 3.43
767 770 2.031683 GCGGATTCGGAATTGTAACCAG 59.968 50.000 4.47 0.22 36.79 4.00
890 893 2.421619 CAGTCTTTCACTTCTGCCTCC 58.578 52.381 0.00 0.00 30.26 4.30
989 992 5.107491 GCGGAACCAAAATAAAGCTTTCTTG 60.107 40.000 16.57 16.34 31.78 3.02
1171 1174 3.815809 ACAAGGGTTCAAGTTTCGATCA 58.184 40.909 0.00 0.00 0.00 2.92
1767 1773 6.945072 AGAAGTAAAGAAAAAGTACTGCGTG 58.055 36.000 0.00 0.00 29.90 5.34
1819 1825 6.567687 TTCTTTCGGTTTCATTGATAGCAA 57.432 33.333 0.00 0.00 38.60 3.91
1906 1912 0.391528 TATGCTTGCTGCTCGCTCAA 60.392 50.000 13.19 0.00 43.37 3.02
1931 1937 7.792364 TGTCAGTAGAAGGGAAGAAAAGATA 57.208 36.000 0.00 0.00 0.00 1.98
1954 1960 4.351111 AGTCACTCCTTTTAGGAACATGGT 59.649 41.667 0.00 0.00 45.28 3.55
2056 2062 0.040646 TAGTCGCCTCCTTTCCTCCA 59.959 55.000 0.00 0.00 0.00 3.86
2076 2082 6.589907 CCTCCACCGAAATTTTTCCTAAATTG 59.410 38.462 0.00 0.00 33.68 2.32
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
536 539 7.159372 AGAATGAGAAATCTTTGCAAAATGCT 58.841 30.769 13.84 6.42 45.31 3.79
691 694 8.918116 ACAGAGCATTAGTACTTATTCTGATCA 58.082 33.333 21.77 0.00 35.84 2.92
732 735 0.464036 ATCCGCTAAACCATCGCTCA 59.536 50.000 0.00 0.00 0.00 4.26
780 783 5.361571 TGCTCTAGTGTTGAATCGGGTATAA 59.638 40.000 0.00 0.00 0.00 0.98
890 893 0.040204 AAGAAAGGCATGGGAGTGGG 59.960 55.000 0.00 0.00 0.00 4.61
1171 1174 4.074970 GGATGATCCACTCCGCAAATATT 58.925 43.478 6.60 0.00 36.28 1.28
1767 1773 3.004524 AGTGCCCTTTCGTATAGATCGAC 59.995 47.826 0.00 0.00 37.05 4.20
1906 1912 6.688073 TCTTTTCTTCCCTTCTACTGACAT 57.312 37.500 0.00 0.00 0.00 3.06
1931 1937 4.351111 ACCATGTTCCTAAAAGGAGTGACT 59.649 41.667 0.00 0.00 46.73 3.41
1954 1960 3.859627 GCAACAGTCGTAAGTAAGGCTCA 60.860 47.826 0.00 0.00 39.48 4.26
2056 2062 5.931724 CAGCCAATTTAGGAAAAATTTCGGT 59.068 36.000 0.00 0.00 38.06 4.69
2076 2082 2.206576 AAGGATTTCCAGTCACAGCC 57.793 50.000 0.00 0.00 38.89 4.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.