Multiple sequence alignment - TraesCS1B01G458500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G458500 chr1B 100.000 2234 0 0 1 2234 672541246 672539013 0.000000e+00 4126
1 TraesCS1B01G458500 chr1B 92.157 306 20 4 358 663 614966010 614966311 1.590000e-116 429
2 TraesCS1B01G458500 chr1B 96.266 241 9 0 1 241 600727773 600728013 1.610000e-106 396
3 TraesCS1B01G458500 chr1B 94.776 134 7 0 1272 1405 670589197 670589330 2.250000e-50 209
4 TraesCS1B01G458500 chr1B 91.971 137 9 2 1 136 566101392 566101257 8.140000e-45 191
5 TraesCS1B01G458500 chr1B 91.000 100 4 1 1664 1763 670590723 670590629 1.800000e-26 130
6 TraesCS1B01G458500 chr1B 95.455 66 2 1 911 976 407933786 407933722 1.090000e-18 104
7 TraesCS1B01G458500 chr6B 98.793 2237 23 4 1 2234 596601834 596604069 0.000000e+00 3978
8 TraesCS1B01G458500 chrUn 98.748 2236 26 2 1 2234 171008310 171006075 0.000000e+00 3973
9 TraesCS1B01G458500 chr7A 98.658 2235 27 2 1 2232 638507640 638509874 0.000000e+00 3958
10 TraesCS1B01G458500 chr7A 98.391 2238 30 5 1 2234 708245649 708243414 0.000000e+00 3928
11 TraesCS1B01G458500 chr5B 98.257 2238 35 3 1 2234 567280020 567277783 0.000000e+00 3914
12 TraesCS1B01G458500 chr2B 97.856 2239 43 3 1 2234 391225217 391227455 0.000000e+00 3864
13 TraesCS1B01G458500 chr4B 97.719 2236 46 4 1 2234 495567986 495565754 0.000000e+00 3842
14 TraesCS1B01G458500 chr5A 94.151 872 41 3 846 1717 645719234 645718373 0.000000e+00 1319
15 TraesCS1B01G458500 chr5A 90.940 298 18 6 1043 1339 327915706 327915995 2.080000e-105 392


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G458500 chr1B 672539013 672541246 2233 True 4126 4126 100.000 1 2234 1 chr1B.!!$R4 2233
1 TraesCS1B01G458500 chr6B 596601834 596604069 2235 False 3978 3978 98.793 1 2234 1 chr6B.!!$F1 2233
2 TraesCS1B01G458500 chrUn 171006075 171008310 2235 True 3973 3973 98.748 1 2234 1 chrUn.!!$R1 2233
3 TraesCS1B01G458500 chr7A 638507640 638509874 2234 False 3958 3958 98.658 1 2232 1 chr7A.!!$F1 2231
4 TraesCS1B01G458500 chr7A 708243414 708245649 2235 True 3928 3928 98.391 1 2234 1 chr7A.!!$R1 2233
5 TraesCS1B01G458500 chr5B 567277783 567280020 2237 True 3914 3914 98.257 1 2234 1 chr5B.!!$R1 2233
6 TraesCS1B01G458500 chr2B 391225217 391227455 2238 False 3864 3864 97.856 1 2234 1 chr2B.!!$F1 2233
7 TraesCS1B01G458500 chr4B 495565754 495567986 2232 True 3842 3842 97.719 1 2234 1 chr4B.!!$R1 2233
8 TraesCS1B01G458500 chr5A 645718373 645719234 861 True 1319 1319 94.151 846 1717 1 chr5A.!!$R1 871

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
468 476 0.108377 TTCGCAATAGCAGCTCCGAA 60.108 50.0 0.0 7.09 42.27 4.3 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1479 1490 3.134081 TCTCCTTTTGAGACCGTGAAAGT 59.866 43.478 0.0 0.0 45.29 2.66 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
61 62 3.380637 AGTCGATCTATTACAACCAGCGT 59.619 43.478 0.0 0.00 0.00 5.07
214 215 3.721706 CGGCTTGCTTCTCCCCCT 61.722 66.667 0.0 0.00 0.00 4.79
218 219 2.614013 TTGCTTCTCCCCCTCCCC 60.614 66.667 0.0 0.00 0.00 4.81
294 295 2.168521 TGTTGAAGCGGAATAGGAGGAG 59.831 50.000 0.0 0.00 0.00 3.69
468 476 0.108377 TTCGCAATAGCAGCTCCGAA 60.108 50.000 0.0 7.09 42.27 4.30
863 872 4.373116 GTCTGAGGGTTCGCCGCA 62.373 66.667 0.0 0.00 38.45 5.69
1190 1201 5.331876 GCAGTTAGCTTTCCTCTAGAAGA 57.668 43.478 0.0 0.00 41.15 2.87
1479 1490 2.167693 CCAATGGACGTAACCAGCTCTA 59.832 50.000 0.0 0.00 43.49 2.43
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
70 71 7.122650 TCGGCTTGGAAGAAGAAAATGAAATAT 59.877 33.333 0.0 0.0 0.00 1.28
214 215 0.696143 TCCATTTCATAGGCGGGGGA 60.696 55.000 0.0 0.0 0.00 4.81
218 219 3.081804 GGGTTATCCATTTCATAGGCGG 58.918 50.000 0.0 0.0 35.00 6.13
294 295 3.598019 TTCTTTCAAGAATGCATGGCC 57.402 42.857 0.0 0.0 39.95 5.36
739 747 1.145119 GGGAAAGTGAACTCCTGGGTT 59.855 52.381 0.0 0.0 31.88 4.11
863 872 3.904136 GTGTAAGCACAGCAATGAACT 57.096 42.857 0.0 0.0 44.64 3.01
1190 1201 4.876107 GTCGATTTATCCACACTTCCATGT 59.124 41.667 0.0 0.0 0.00 3.21
1479 1490 3.134081 TCTCCTTTTGAGACCGTGAAAGT 59.866 43.478 0.0 0.0 45.29 2.66


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.