Multiple sequence alignment - TraesCS1B01G458400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G458400 chr1B 100.000 2314 0 0 1 2314 672527983 672525670 0 4274
1 TraesCS1B01G458400 chrUn 98.401 2314 37 0 1 2314 170995032 170992719 0 4069
2 TraesCS1B01G458400 chr7B 98.359 2315 37 1 1 2314 743095875 743098189 0 4063
3 TraesCS1B01G458400 chr7B 98.272 2315 39 1 1 2314 644446412 644448726 0 4052
4 TraesCS1B01G458400 chr7B 97.149 2315 63 3 1 2314 54063139 54065451 0 3906
5 TraesCS1B01G458400 chr6B 97.840 2315 48 2 1 2314 307014538 307012225 0 3997
6 TraesCS1B01G458400 chr6B 96.889 2314 72 0 1 2314 264960615 264962928 0 3875
7 TraesCS1B01G458400 chr1A 97.322 2315 60 2 1 2314 94677203 94679516 0 3930
8 TraesCS1B01G458400 chr4B 97.235 2315 59 5 1 2314 623334089 623331779 0 3916
9 TraesCS1B01G458400 chr7A 97.155 2320 59 4 1 2314 211377603 211379921 0 3912


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G458400 chr1B 672525670 672527983 2313 True 4274 4274 100.000 1 2314 1 chr1B.!!$R1 2313
1 TraesCS1B01G458400 chrUn 170992719 170995032 2313 True 4069 4069 98.401 1 2314 1 chrUn.!!$R1 2313
2 TraesCS1B01G458400 chr7B 743095875 743098189 2314 False 4063 4063 98.359 1 2314 1 chr7B.!!$F3 2313
3 TraesCS1B01G458400 chr7B 644446412 644448726 2314 False 4052 4052 98.272 1 2314 1 chr7B.!!$F2 2313
4 TraesCS1B01G458400 chr7B 54063139 54065451 2312 False 3906 3906 97.149 1 2314 1 chr7B.!!$F1 2313
5 TraesCS1B01G458400 chr6B 307012225 307014538 2313 True 3997 3997 97.840 1 2314 1 chr6B.!!$R1 2313
6 TraesCS1B01G458400 chr6B 264960615 264962928 2313 False 3875 3875 96.889 1 2314 1 chr6B.!!$F1 2313
7 TraesCS1B01G458400 chr1A 94677203 94679516 2313 False 3930 3930 97.322 1 2314 1 chr1A.!!$F1 2313
8 TraesCS1B01G458400 chr4B 623331779 623334089 2310 True 3916 3916 97.235 1 2314 1 chr4B.!!$R1 2313
9 TraesCS1B01G458400 chr7A 211377603 211379921 2318 False 3912 3912 97.155 1 2314 1 chr7A.!!$F1 2313

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
232 233 0.186386 AGACCTACTCCCTCCCATCG 59.814 60.0 0.0 0.0 0.0 3.84 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2128 2138 0.185901 AGGAACAAGGCTTGAAGGCA 59.814 50.0 32.5 0.0 44.19 4.75 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
232 233 0.186386 AGACCTACTCCCTCCCATCG 59.814 60.000 0.00 0.0 0.00 3.84
280 281 4.941263 TCCAGTCACCAACATTAGCATAAC 59.059 41.667 0.00 0.0 0.00 1.89
338 339 2.930023 GCTATGCGGATCCTCAGACATG 60.930 54.545 10.73 0.0 0.00 3.21
430 431 4.092091 GCTATCGAACACAGAGTCAAAAGG 59.908 45.833 0.00 0.0 0.00 3.11
464 465 1.431488 GCCAATCTGCGAATCGAGCA 61.431 55.000 6.91 0.0 42.99 4.26
466 467 1.267732 CCAATCTGCGAATCGAGCAAC 60.268 52.381 6.91 0.0 44.67 4.17
639 640 1.032014 TTCCTTTGCCACTCAAGTGC 58.968 50.000 4.58 1.8 44.34 4.40
908 913 7.500892 AGAGTTATTCAGTCGATACAGAGATGT 59.499 37.037 0.00 0.0 0.00 3.06
970 975 4.894896 CCCATAAGGCCCCACCGC 62.895 72.222 0.00 0.0 46.52 5.68
1845 1855 1.755200 AAGGTAAAGAGAAGGGGCCA 58.245 50.000 4.39 0.0 0.00 5.36
1888 1898 8.698973 ATCTTTCCTATCTACGATCTTTCTCA 57.301 34.615 0.00 0.0 0.00 3.27
2127 2137 6.489022 TCATCAGATTCATTCCCTTGCTAATG 59.511 38.462 0.00 0.0 34.96 1.90
2128 2138 5.759059 TCAGATTCATTCCCTTGCTAATGT 58.241 37.500 0.00 0.0 35.16 2.71
2215 2226 5.897050 AGTAGAAAGAAATCCTAGCAGTCG 58.103 41.667 0.00 0.0 0.00 4.18
2240 2251 5.688807 TGAGATTGAATCCAGAGGAAATCC 58.311 41.667 0.75 0.0 34.34 3.01
2244 2255 4.673328 TGAATCCAGAGGAAATCCCAAA 57.327 40.909 0.00 0.0 34.34 3.28
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
23 24 3.446442 AGTGCTCCCAGAAATGAATGT 57.554 42.857 0.00 0.00 0.00 2.71
232 233 9.943163 GAGATAACTTTCTTCAATTATTCCTGC 57.057 33.333 0.00 0.00 0.00 4.85
338 339 8.463930 TGGTCCATCTTTATTCCATTTCATAC 57.536 34.615 0.00 0.00 0.00 2.39
430 431 2.396590 TTGGCCTGACTCGTAATTCC 57.603 50.000 3.32 0.00 0.00 3.01
464 465 1.077663 ACATCATTGCAAGGGGAGGTT 59.922 47.619 11.73 0.00 0.00 3.50
466 467 1.108776 CACATCATTGCAAGGGGAGG 58.891 55.000 11.73 9.63 0.00 4.30
548 549 2.373169 AGAAGATCAAGTTGGTGAGCCA 59.627 45.455 2.34 0.00 44.38 4.75
947 952 2.012794 GGGGCCTTATGGGGAAGGT 61.013 63.158 0.84 0.00 46.73 3.50
976 981 0.448197 GTAGCAAGAGGGCGCTTTTC 59.552 55.000 7.64 2.53 39.70 2.29
978 983 1.377333 GGTAGCAAGAGGGCGCTTT 60.377 57.895 7.64 0.00 39.70 3.51
1538 1548 1.237285 ATGACAGGCCGCTTGAACAC 61.237 55.000 9.83 0.00 0.00 3.32
1845 1855 4.142609 AGATCTGTTATGCACCAACGAT 57.857 40.909 14.40 14.40 0.00 3.73
1909 1919 4.530710 TTGCTTATGTGGTACTTCGACT 57.469 40.909 0.00 0.00 0.00 4.18
2091 2101 7.094032 GGAATGAATCTGATGAAGTTGTTCCTT 60.094 37.037 0.00 0.00 0.00 3.36
2127 2137 0.315251 GGAACAAGGCTTGAAGGCAC 59.685 55.000 32.50 15.29 44.19 5.01
2128 2138 0.185901 AGGAACAAGGCTTGAAGGCA 59.814 50.000 32.50 0.00 44.19 4.75
2215 2226 6.039159 GGATTTCCTCTGGATTCAATCTCAAC 59.961 42.308 0.00 0.00 31.09 3.18
2240 2251 2.161609 GCTCTCACGGTAATTGGTTTGG 59.838 50.000 0.00 0.00 0.00 3.28
2244 2255 0.892755 TCGCTCTCACGGTAATTGGT 59.107 50.000 0.00 0.00 0.00 3.67


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.