Multiple sequence alignment - TraesCS1B01G458300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G458300 chr1B 100.000 2357 0 0 1 2357 672508550 672506194 0 4353
1 TraesCS1B01G458300 chr1A 98.898 2359 24 2 1 2357 238109745 238107387 0 4211
2 TraesCS1B01G458300 chr1A 98.728 2359 28 2 1 2357 238155130 238152772 0 4189
3 TraesCS1B01G458300 chr5A 98.728 2359 28 2 1 2357 16577920 16575562 0 4189
4 TraesCS1B01G458300 chr7A 98.474 2359 34 2 1 2357 60329010 60326652 0 4156
5 TraesCS1B01G458300 chr7D 98.389 2359 33 3 1 2357 579015578 579017933 0 4141
6 TraesCS1B01G458300 chr6B 98.304 2359 34 4 1 2357 596657306 596654952 0 4130
7 TraesCS1B01G458300 chrUn 98.304 2359 32 4 1 2357 237257830 237255478 0 4128


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G458300 chr1B 672506194 672508550 2356 True 4353 4353 100.000 1 2357 1 chr1B.!!$R1 2356
1 TraesCS1B01G458300 chr1A 238107387 238109745 2358 True 4211 4211 98.898 1 2357 1 chr1A.!!$R1 2356
2 TraesCS1B01G458300 chr1A 238152772 238155130 2358 True 4189 4189 98.728 1 2357 1 chr1A.!!$R2 2356
3 TraesCS1B01G458300 chr5A 16575562 16577920 2358 True 4189 4189 98.728 1 2357 1 chr5A.!!$R1 2356
4 TraesCS1B01G458300 chr7A 60326652 60329010 2358 True 4156 4156 98.474 1 2357 1 chr7A.!!$R1 2356
5 TraesCS1B01G458300 chr7D 579015578 579017933 2355 False 4141 4141 98.389 1 2357 1 chr7D.!!$F1 2356
6 TraesCS1B01G458300 chr6B 596654952 596657306 2354 True 4130 4130 98.304 1 2357 1 chr6B.!!$R1 2356
7 TraesCS1B01G458300 chrUn 237255478 237257830 2352 True 4128 4128 98.304 1 2357 1 chrUn.!!$R1 2356

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
188 189 2.35361 GGTCGGGTCGGAGGCTAAA 61.354 63.158 0.0 0.0 0.0 1.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2045 2049 1.338973 CACAATTTCCTGCACTGTGCT 59.661 47.619 30.43 9.15 45.31 4.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
188 189 2.353610 GGTCGGGTCGGAGGCTAAA 61.354 63.158 0.00 0.0 0.00 1.85
442 443 5.643348 GCTTAAGGCATTGGTTTGCTAAATT 59.357 36.000 4.29 0.0 42.38 1.82
587 588 3.094484 AGCTGCTTAGTGACTAGGAGT 57.906 47.619 5.87 0.0 0.00 3.85
962 964 4.441695 CTCCGCGAGCAAGGAGCA 62.442 66.667 8.23 0.0 46.23 4.26
1485 1488 1.139853 GAGCTTCGGATCAATGTCCCT 59.860 52.381 0.00 0.0 34.67 4.20
1579 1582 3.304391 GCAAAAGTACGGTTGAGCAATCA 60.304 43.478 13.74 0.0 0.00 2.57
2025 2029 5.810587 TGATCTTTTAGTAGGCTAAGTTGCG 59.189 40.000 0.00 0.0 38.31 4.85
2045 2049 5.000591 TGCGGAATTCTGAAATCACTACAA 58.999 37.500 18.72 0.0 0.00 2.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
9 10 5.350504 AGAAGTCCATTCTCGTCATGATT 57.649 39.130 0.00 0.00 45.50 2.57
34 35 7.492669 CGTGACTCTTCTAAACCATTACATGAT 59.507 37.037 0.00 0.00 0.00 2.45
157 158 1.203075 ACCCGACCAAGAGAGAAGACT 60.203 52.381 0.00 0.00 0.00 3.24
188 189 4.202503 ACACCTCACCACTGAATGAGAAAT 60.203 41.667 10.40 0.00 44.32 2.17
442 443 7.716560 CCCATGATACAATCTTCTTGTATGTCA 59.283 37.037 13.67 8.85 43.39 3.58
587 588 2.034066 CAAGAAAGGGGCGCTCCA 59.966 61.111 31.81 0.00 37.22 3.86
1042 1044 4.894784 AGTGGAATCAAAGAAACTAGCGA 58.105 39.130 0.00 0.00 0.00 4.93
1197 1200 6.100569 TGACTTCCGGATCAGGGATAATAAAA 59.899 38.462 4.15 0.00 32.58 1.52
1485 1488 2.158900 GCAGGCATACTCCTTGCTTCTA 60.159 50.000 0.00 0.00 40.03 2.10
1542 1545 8.350722 CCGTACTTTTGCTATCTTATGTAGAGA 58.649 37.037 0.00 0.00 36.02 3.10
1549 1552 6.258068 GCTCAACCGTACTTTTGCTATCTTAT 59.742 38.462 0.00 0.00 0.00 1.73
1579 1582 8.467963 TGGAATGTGAGCAAATATATCATGTT 57.532 30.769 0.00 0.00 0.00 2.71
2025 2029 6.072508 TGTGCTTGTAGTGATTTCAGAATTCC 60.073 38.462 0.65 0.00 0.00 3.01
2045 2049 1.338973 CACAATTTCCTGCACTGTGCT 59.661 47.619 30.43 9.15 45.31 4.40
2300 2304 9.189156 ACAAATGCCATTATTAGTACTGTCAAT 57.811 29.630 5.39 0.00 0.00 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.