Multiple sequence alignment - TraesCS1B01G458200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G458200 chr1B 100.000 3215 0 0 1 3215 672479240 672482454 0 5938
1 TraesCS1B01G458200 chr1B 97.485 3221 73 4 1 3215 638700587 638697369 0 5493
2 TraesCS1B01G458200 chr4D 98.415 3217 49 2 1 3215 123299969 123303185 0 5657
3 TraesCS1B01G458200 chr7B 98.290 3216 54 1 1 3215 644467523 644470738 0 5633
4 TraesCS1B01G458200 chr7D 98.074 3219 58 3 1 3215 203515555 203518773 0 5598
5 TraesCS1B01G458200 chr3A 97.947 3215 64 2 1 3215 633111333 633114545 0 5570
6 TraesCS1B01G458200 chr6B 97.701 3219 70 1 1 3215 306995911 306992693 0 5531
7 TraesCS1B01G458200 chr2A 97.327 3217 81 4 1 3215 332944218 332941005 0 5459
8 TraesCS1B01G458200 chr2B 97.203 3218 87 2 1 3215 391112762 391109545 0 5441
9 TraesCS1B01G458200 chr3B 94.810 3218 159 6 1 3215 368856884 368853672 0 5011


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G458200 chr1B 672479240 672482454 3214 False 5938 5938 100.000 1 3215 1 chr1B.!!$F1 3214
1 TraesCS1B01G458200 chr1B 638697369 638700587 3218 True 5493 5493 97.485 1 3215 1 chr1B.!!$R1 3214
2 TraesCS1B01G458200 chr4D 123299969 123303185 3216 False 5657 5657 98.415 1 3215 1 chr4D.!!$F1 3214
3 TraesCS1B01G458200 chr7B 644467523 644470738 3215 False 5633 5633 98.290 1 3215 1 chr7B.!!$F1 3214
4 TraesCS1B01G458200 chr7D 203515555 203518773 3218 False 5598 5598 98.074 1 3215 1 chr7D.!!$F1 3214
5 TraesCS1B01G458200 chr3A 633111333 633114545 3212 False 5570 5570 97.947 1 3215 1 chr3A.!!$F1 3214
6 TraesCS1B01G458200 chr6B 306992693 306995911 3218 True 5531 5531 97.701 1 3215 1 chr6B.!!$R1 3214
7 TraesCS1B01G458200 chr2A 332941005 332944218 3213 True 5459 5459 97.327 1 3215 1 chr2A.!!$R1 3214
8 TraesCS1B01G458200 chr2B 391109545 391112762 3217 True 5441 5441 97.203 1 3215 1 chr2B.!!$R1 3214
9 TraesCS1B01G458200 chr3B 368853672 368856884 3212 True 5011 5011 94.810 1 3215 1 chr3B.!!$R1 3214

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
940 954 0.465705 CGCCTTCCTCATAGAAGCCA 59.534 55.0 0.0 0.0 41.65 4.75 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2635 2652 0.097325 GTACGTGAGACTCTCGCCTG 59.903 60.0 23.02 4.0 37.68 4.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
76 78 4.227134 CGGGCCCGAGAGTGATGG 62.227 72.222 41.82 4.63 42.83 3.51
105 107 4.345859 TCCTTAAAGAGCCTTTCGTTCA 57.654 40.909 3.80 0.00 0.00 3.18
198 202 4.632153 TGAAGAAAGAAAGAAGGGTCGAG 58.368 43.478 0.00 0.00 0.00 4.04
778 782 0.890542 AGAGCATCCAACGCAAAGCA 60.891 50.000 0.00 0.00 33.66 3.91
857 870 1.157585 GGAGACCAGAAAACGCCTTC 58.842 55.000 0.00 0.00 0.00 3.46
940 954 0.465705 CGCCTTCCTCATAGAAGCCA 59.534 55.000 0.00 0.00 41.65 4.75
1035 1049 6.311735 TCTTAAGTATTGCAAAAGAAGGGGT 58.688 36.000 1.71 0.00 0.00 4.95
1159 1173 0.806492 TTGTTACGCGCGATATGCCA 60.806 50.000 39.36 19.56 42.08 4.92
1440 1454 0.825010 GCTCCGCCATCCATTCCAAT 60.825 55.000 0.00 0.00 0.00 3.16
1512 1526 1.209019 AGCGGAAGAGGTCGTCTACTA 59.791 52.381 0.00 0.00 32.65 1.82
1600 1614 1.296715 GGGACCGTCAAGCACATCT 59.703 57.895 0.00 0.00 0.00 2.90
1610 1624 3.057033 GTCAAGCACATCTGGCAAAGATT 60.057 43.478 0.00 0.00 43.52 2.40
1740 1754 4.257654 TTTGGTCGGAAGGCGGCA 62.258 61.111 13.08 0.00 35.76 5.69
1775 1790 0.322456 CACTGGGCGGGATCTTTCAA 60.322 55.000 0.00 0.00 0.00 2.69
1832 1847 6.800540 ATCAAAAAGATACTCCGAAGGCTTCA 60.801 38.462 25.66 7.35 41.54 3.02
2064 2079 1.878953 AATCTTCGGCGCGGAATATT 58.121 45.000 27.60 26.42 0.00 1.28
2265 2280 3.871594 ACAGGCGTTTACATGAGATTAGC 59.128 43.478 0.00 0.00 0.00 3.09
2767 2784 0.322906 CTCTTTCCAGGAGGTTGGCC 60.323 60.000 0.00 0.00 38.16 5.36
2786 2803 2.808919 CCGCCTATCCTAGATCTTCCA 58.191 52.381 0.00 0.00 0.00 3.53
2867 2884 5.509716 TTCTATATATATGGGTCCGTGCG 57.490 43.478 5.44 0.00 0.00 5.34
2880 2897 2.950673 GTGCGGCATTTCCACGAA 59.049 55.556 5.72 0.00 34.01 3.85
3084 3101 2.503765 TGGGGATTCATTGCTCGTTCTA 59.496 45.455 0.00 0.00 0.00 2.10
3182 3199 1.913762 CAACACCCTCTCCTCCGGT 60.914 63.158 0.00 0.00 0.00 5.28
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
19 20 2.636893 CGGGGATCTCTCCAATCATTCT 59.363 50.000 0.00 0.00 44.08 2.40
35 36 3.864983 AACCAAGAGGAGGCGGGGA 62.865 63.158 0.00 0.00 38.69 4.81
198 202 7.036996 AGAACTACTATAAGCGGTCTAAACC 57.963 40.000 0.00 0.00 42.66 3.27
213 217 9.931698 TGATCTTTTCTATGGGTAGAACTACTA 57.068 33.333 11.04 2.94 44.47 1.82
778 782 3.958147 ACGAAACAAGGGAATGAAAGGTT 59.042 39.130 0.00 0.00 0.00 3.50
966 980 8.834004 TCTTATTAAAGCCTTCTCTACCACTA 57.166 34.615 0.00 0.00 32.36 2.74
968 982 8.966069 ATTCTTATTAAAGCCTTCTCTACCAC 57.034 34.615 0.00 0.00 32.36 4.16
1159 1173 3.760684 ACGATTCCCAGTAGTAAGTCGTT 59.239 43.478 0.00 0.00 37.77 3.85
1296 1310 1.406903 CCGTACCGGGGAATTCTACT 58.593 55.000 6.32 0.00 44.15 2.57
1440 1454 7.958016 GGGATACTATAACCTAGGTCCCTAAAA 59.042 40.741 16.64 0.00 38.99 1.52
1512 1526 1.443872 CGCTAGTTGAACCGCGTCT 60.444 57.895 17.68 0.00 40.64 4.18
1600 1614 1.009997 ATCCCCCTCAATCTTTGCCA 58.990 50.000 0.00 0.00 0.00 4.92
1610 1624 0.613260 CAACAACGAGATCCCCCTCA 59.387 55.000 0.00 0.00 32.86 3.86
1663 1677 1.344438 TCGTGAGACTGCCTGTTGAAT 59.656 47.619 0.00 0.00 33.31 2.57
1740 1754 1.541620 GTGTCCCCTTCCTTCCCCT 60.542 63.158 0.00 0.00 0.00 4.79
1775 1790 1.837439 TCTGTATGGGGAATTCGCTGT 59.163 47.619 20.49 12.43 0.00 4.40
1832 1847 2.243810 GGCTAATGAGACCTCGATCCT 58.756 52.381 0.00 0.00 0.00 3.24
2064 2079 6.266080 TGAGTCTTTGGGGTACTTTAGGATA 58.734 40.000 0.00 0.00 0.00 2.59
2519 2535 6.658849 TGATTCAAGGTAGCTTTAGCCATTA 58.341 36.000 3.96 0.00 43.38 1.90
2635 2652 0.097325 GTACGTGAGACTCTCGCCTG 59.903 60.000 23.02 4.00 37.68 4.85
2767 2784 5.413309 AATTGGAAGATCTAGGATAGGCG 57.587 43.478 0.00 0.00 39.78 5.52
2786 2803 6.041523 TCGAACAAGGGATCTTTTTGGAAATT 59.958 34.615 0.00 0.00 29.01 1.82
2841 2858 7.101054 GCACGGACCCATATATATAGAAACAA 58.899 38.462 0.00 0.00 0.00 2.83
2880 2897 8.924511 AGTCCCATTAATTGATCATAACGATT 57.075 30.769 0.00 0.00 33.17 3.34
3084 3101 4.734695 GCTGGCTACGTTACTTATAACCGT 60.735 45.833 0.00 0.00 37.94 4.83


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.