Multiple sequence alignment - TraesCS1B01G458100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G458100 chr1B 100.000 2255 0 0 1 2255 672477345 672479599 0 4165
1 TraesCS1B01G458100 chr1B 98.537 2256 31 2 1 2255 638702482 638700228 0 3982
2 TraesCS1B01G458100 chr1D 99.113 2255 19 1 1 2255 141314951 141312698 0 4052
3 TraesCS1B01G458100 chr7B 99.025 2256 21 1 1 2255 644465627 644467882 0 4043
4 TraesCS1B01G458100 chr3A 98.936 2255 24 0 1 2255 633109438 633111692 0 4032
5 TraesCS1B01G458100 chr7A 98.891 2255 25 0 1 2255 60150103 60147849 0 4026
6 TraesCS1B01G458100 chr7A 97.958 2253 45 1 3 2255 46399060 46396809 0 3904
7 TraesCS1B01G458100 chr6B 98.581 2255 32 0 1 2255 306997806 306995552 0 3988
8 TraesCS1B01G458100 chr4B 98.492 2255 33 1 1 2255 209079333 209077080 0 3975


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G458100 chr1B 672477345 672479599 2254 False 4165 4165 100.000 1 2255 1 chr1B.!!$F1 2254
1 TraesCS1B01G458100 chr1B 638700228 638702482 2254 True 3982 3982 98.537 1 2255 1 chr1B.!!$R1 2254
2 TraesCS1B01G458100 chr1D 141312698 141314951 2253 True 4052 4052 99.113 1 2255 1 chr1D.!!$R1 2254
3 TraesCS1B01G458100 chr7B 644465627 644467882 2255 False 4043 4043 99.025 1 2255 1 chr7B.!!$F1 2254
4 TraesCS1B01G458100 chr3A 633109438 633111692 2254 False 4032 4032 98.936 1 2255 1 chr3A.!!$F1 2254
5 TraesCS1B01G458100 chr7A 60147849 60150103 2254 True 4026 4026 98.891 1 2255 1 chr7A.!!$R2 2254
6 TraesCS1B01G458100 chr7A 46396809 46399060 2251 True 3904 3904 97.958 3 2255 1 chr7A.!!$R1 2252
7 TraesCS1B01G458100 chr6B 306995552 306997806 2254 True 3988 3988 98.581 1 2255 1 chr6B.!!$R1 2254
8 TraesCS1B01G458100 chr4B 209077080 209079333 2253 True 3975 3975 98.492 1 2255 1 chr4B.!!$R1 2254

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
496 497 1.112113 GGAGAGACTCGGTTATGGCA 58.888 55.0 0.0 0.0 0.0 4.92 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1841 1843 0.798776 CGGGTGAATCAGTTCAGTGC 59.201 55.0 0.0 0.0 44.58 4.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
74 75 5.848921 AGAGATAGGGGTTTGCTATTCTCAT 59.151 40.000 0.00 0.00 0.00 2.90
390 391 5.423704 TTTTTCATGTACCAGATCCGGTA 57.576 39.130 3.54 3.54 40.67 4.02
496 497 1.112113 GGAGAGACTCGGTTATGGCA 58.888 55.000 0.00 0.00 0.00 4.92
508 509 3.202906 GGTTATGGCACGATAAAGAGCA 58.797 45.455 0.00 0.00 0.00 4.26
933 935 3.936203 GGGTCCCGTGTGTGCTCA 61.936 66.667 0.00 0.00 0.00 4.26
1455 1457 9.253832 CCTTCTACTATCAACCAGATGAGATAT 57.746 37.037 0.00 0.00 37.57 1.63
1841 1843 4.518249 CTTAAGTTTAGGCTCCCTTCCTG 58.482 47.826 0.00 0.00 34.61 3.86
2000 2002 4.345859 TCCTTAAAGAGCCTTTCGTTCA 57.654 40.909 3.80 0.00 0.00 3.18
2093 2096 4.632153 TGAAGAAAGAAAGAAGGGTCGAG 58.368 43.478 0.00 0.00 0.00 4.04
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
74 75 7.301420 TGGGGTAAATAAATATGAGCAATCCA 58.699 34.615 0.00 0.00 0.00 3.41
390 391 4.312443 CATTTTTGCTTGATGTCTGGCTT 58.688 39.130 0.00 0.00 0.00 4.35
496 497 4.497006 GCATTGAAGCATGCTCTTTATCGT 60.497 41.667 22.93 1.48 40.41 3.73
508 509 2.617308 CTGAATCCGAGCATTGAAGCAT 59.383 45.455 0.00 0.00 36.85 3.79
1455 1457 2.172505 TGACTCTGACCTTTCAAAGCCA 59.827 45.455 0.00 0.00 0.00 4.75
1841 1843 0.798776 CGGGTGAATCAGTTCAGTGC 59.201 55.000 0.00 0.00 44.58 4.40
1914 1916 2.636893 CGGGGATCTCTCCAATCATTCT 59.363 50.000 0.00 0.00 44.08 2.40
1930 1932 3.864983 AACCAAGAGGAGGCGGGGA 62.865 63.158 0.00 0.00 38.69 4.81
2093 2096 7.036996 AGAACTACTATAAGCGGTCTAAACC 57.963 40.000 0.00 0.00 42.66 3.27
2108 2111 9.931698 TGATCTTTTCTATGGGTAGAACTACTA 57.068 33.333 11.04 2.94 44.47 1.82


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.