Multiple sequence alignment - TraesCS1B01G451000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G451000 chr1B 100.000 2888 0 0 1 2888 668810691 668807804 0 5334
1 TraesCS1B01G451000 chr1B 98.685 2889 32 5 1 2888 638706193 638703310 0 5120
2 TraesCS1B01G451000 chr1B 98.476 2888 40 2 1 2888 672473634 672476517 0 5086
3 TraesCS1B01G451000 chr7B 99.134 2888 22 2 1 2888 644461915 644464799 0 5192
4 TraesCS1B01G451000 chrUn 99.100 2888 23 2 1 2888 189405555 189408439 0 5186
5 TraesCS1B01G451000 chr7D 99.031 2889 22 4 1 2888 381960689 381957806 0 5175
6 TraesCS1B01G451000 chr7D 98.996 2888 24 3 1 2888 382063150 382066032 0 5168
7 TraesCS1B01G451000 chr7D 98.823 2888 29 4 1 2888 626684764 626681882 0 5140
8 TraesCS1B01G451000 chr6D 98.892 2888 25 4 1 2888 124530594 124533474 0 5149
9 TraesCS1B01G451000 chr1D 98.789 2889 27 5 1 2888 141318662 141315781 0 5134


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G451000 chr1B 668807804 668810691 2887 True 5334 5334 100.000 1 2888 1 chr1B.!!$R2 2887
1 TraesCS1B01G451000 chr1B 638703310 638706193 2883 True 5120 5120 98.685 1 2888 1 chr1B.!!$R1 2887
2 TraesCS1B01G451000 chr1B 672473634 672476517 2883 False 5086 5086 98.476 1 2888 1 chr1B.!!$F1 2887
3 TraesCS1B01G451000 chr7B 644461915 644464799 2884 False 5192 5192 99.134 1 2888 1 chr7B.!!$F1 2887
4 TraesCS1B01G451000 chrUn 189405555 189408439 2884 False 5186 5186 99.100 1 2888 1 chrUn.!!$F1 2887
5 TraesCS1B01G451000 chr7D 381957806 381960689 2883 True 5175 5175 99.031 1 2888 1 chr7D.!!$R1 2887
6 TraesCS1B01G451000 chr7D 382063150 382066032 2882 False 5168 5168 98.996 1 2888 1 chr7D.!!$F1 2887
7 TraesCS1B01G451000 chr7D 626681882 626684764 2882 True 5140 5140 98.823 1 2888 1 chr7D.!!$R2 2887
8 TraesCS1B01G451000 chr6D 124530594 124533474 2880 False 5149 5149 98.892 1 2888 1 chr6D.!!$F1 2887
9 TraesCS1B01G451000 chr1D 141315781 141318662 2881 True 5134 5134 98.789 1 2888 1 chr1D.!!$R1 2887

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
31 32 3.857665 TCTTGATAAACGACTCGATGCAC 59.142 43.478 5.20 0.0 0.00 4.57 F
643 646 4.114073 TGAACTTCGTTCGCAAAGTAAGA 58.886 39.130 2.71 0.0 44.55 2.10 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1076 1079 0.793861 CGTTCCATTCTTTTCGGCGA 59.206 50.00 4.99 4.99 0.0 5.54 R
2810 2818 4.151883 ACCCAACATGCATTTTAGAGTGT 58.848 39.13 0.00 0.00 0.0 3.55 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
31 32 3.857665 TCTTGATAAACGACTCGATGCAC 59.142 43.478 5.20 0.00 0.00 4.57
643 646 4.114073 TGAACTTCGTTCGCAAAGTAAGA 58.886 39.130 2.71 0.00 44.55 2.10
825 828 5.925397 GTCTATCGATGAACAGCAGATTGAT 59.075 40.000 8.54 0.00 0.00 2.57
1076 1079 3.924507 GCCAATGCGGAAGGATGT 58.075 55.556 2.92 0.00 43.29 3.06
1431 1434 5.821516 TGACATGTCGGTTGTTTTTAACT 57.178 34.783 20.54 0.00 0.00 2.24
1968 1971 0.170561 GCGCTTCGGAAGTCACTCTA 59.829 55.000 18.32 0.00 0.00 2.43
2106 2110 2.224523 TGGAAACGCCTCACAATCTTCT 60.225 45.455 0.00 0.00 37.63 2.85
2791 2799 3.695606 ATGCGTGACTGGCGGAGT 61.696 61.111 0.00 0.00 37.76 3.85
2810 2818 3.536917 CCTATCGCCCTGGCACGA 61.537 66.667 9.17 11.63 43.33 4.35
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
31 32 0.801251 CAGCGGCAAGGAAGAGAAAG 59.199 55.000 1.45 0.00 0.00 2.62
358 360 5.429762 AGACCATGTCCCTGAGATTTGATAA 59.570 40.000 0.00 0.00 32.18 1.75
359 361 4.971282 AGACCATGTCCCTGAGATTTGATA 59.029 41.667 0.00 0.00 32.18 2.15
514 517 2.359848 TCACGAAGTTCGAGACAAAGGA 59.640 45.455 30.77 11.55 43.74 3.36
643 646 0.608308 GCTGGCCCGTTAAAAGGACT 60.608 55.000 0.00 0.00 29.76 3.85
730 733 0.105224 TTTCCTTCTCGCGAACCACA 59.895 50.000 11.33 0.00 0.00 4.17
825 828 0.251474 AAGCAATGCCAAGAGCTCCA 60.251 50.000 10.93 0.80 44.23 3.86
1076 1079 0.793861 CGTTCCATTCTTTTCGGCGA 59.206 50.000 4.99 4.99 0.00 5.54
1293 1296 1.458064 CCATTACGAACGACACGCTTT 59.542 47.619 0.14 0.00 0.00 3.51
2810 2818 4.151883 ACCCAACATGCATTTTAGAGTGT 58.848 39.130 0.00 0.00 0.00 3.55


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.