Multiple sequence alignment - TraesCS1B01G450900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G450900 chr1B 100.000 2636 0 0 1 2636 668809668 668807033 0 4868
1 TraesCS1B01G450900 chr1B 98.825 2638 27 4 1 2636 638705173 638702538 0 4697
2 TraesCS1B01G450900 chr1B 98.635 2637 35 1 1 2636 672474653 672477289 0 4669
3 TraesCS1B01G450900 chr7B 99.204 2637 20 1 1 2636 644462935 644465571 0 4752
4 TraesCS1B01G450900 chrUn 99.090 2637 23 1 1 2636 189406575 189409211 0 4735
5 TraesCS1B01G450900 chrUn 98.824 2636 31 0 1 2636 251410020 251407385 0 4697
6 TraesCS1B01G450900 chr3A 98.749 2637 31 2 1 2636 633106747 633109382 0 4686
7 TraesCS1B01G450900 chr6D 98.711 2638 29 3 1 2636 124531613 124534247 0 4678


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G450900 chr1B 668807033 668809668 2635 True 4868 4868 100.000 1 2636 1 chr1B.!!$R2 2635
1 TraesCS1B01G450900 chr1B 638702538 638705173 2635 True 4697 4697 98.825 1 2636 1 chr1B.!!$R1 2635
2 TraesCS1B01G450900 chr1B 672474653 672477289 2636 False 4669 4669 98.635 1 2636 1 chr1B.!!$F1 2635
3 TraesCS1B01G450900 chr7B 644462935 644465571 2636 False 4752 4752 99.204 1 2636 1 chr7B.!!$F1 2635
4 TraesCS1B01G450900 chrUn 189406575 189409211 2636 False 4735 4735 99.090 1 2636 1 chrUn.!!$F1 2635
5 TraesCS1B01G450900 chrUn 251407385 251410020 2635 True 4697 4697 98.824 1 2636 1 chrUn.!!$R1 2635
6 TraesCS1B01G450900 chr3A 633106747 633109382 2635 False 4686 4686 98.749 1 2636 1 chr3A.!!$F1 2635
7 TraesCS1B01G450900 chr6D 124531613 124534247 2634 False 4678 4678 98.711 1 2636 1 chr6D.!!$F1 2635

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
945 946 0.170561 GCGCTTCGGAAGTCACTCTA 59.829 55.0 18.32 0.0 0.0 2.43 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1787 1790 4.151883 ACCCAACATGCATTTTAGAGTGT 58.848 39.13 0.0 0.0 0.0 3.55 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
53 54 3.924507 GCCAATGCGGAAGGATGT 58.075 55.556 2.92 0.00 43.29 3.06
408 409 5.821516 TGACATGTCGGTTGTTTTTAACT 57.178 34.783 20.54 0.00 0.00 2.24
945 946 0.170561 GCGCTTCGGAAGTCACTCTA 59.829 55.000 18.32 0.00 0.00 2.43
1083 1084 2.224523 TGGAAACGCCTCACAATCTTCT 60.225 45.455 0.00 0.00 37.63 2.85
1768 1771 3.695606 ATGCGTGACTGGCGGAGT 61.696 61.111 0.00 0.00 37.76 3.85
1787 1790 3.536917 CCTATCGCCCTGGCACGA 61.537 66.667 9.17 11.63 43.33 4.35
2172 2175 3.004752 ACCCGCTTGCTTATCTTCATT 57.995 42.857 0.00 0.00 0.00 2.57
2173 2176 3.356290 ACCCGCTTGCTTATCTTCATTT 58.644 40.909 0.00 0.00 0.00 2.32
2594 2600 6.458210 GGAACACATTGATTCCATTTGTTCT 58.542 36.000 20.36 0.00 43.40 3.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
53 54 0.793861 CGTTCCATTCTTTTCGGCGA 59.206 50.000 4.99 4.99 0.0 5.54
270 271 1.458064 CCATTACGAACGACACGCTTT 59.542 47.619 0.14 0.00 0.0 3.51
1787 1790 4.151883 ACCCAACATGCATTTTAGAGTGT 58.848 39.130 0.00 0.00 0.0 3.55


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.