Multiple sequence alignment - TraesCS1B01G431100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G431100 chr1B 100.000 2378 0 0 1 2378 655594251 655596628 0.000000e+00 4392.0
1 TraesCS1B01G431100 chr1B 98.345 1571 25 1 730 2299 655617526 655619096 0.000000e+00 2756.0
2 TraesCS1B01G431100 chr1B 98.113 159 3 0 1 159 655617385 655617543 6.470000e-71 278.0
3 TraesCS1B01G431100 chrUn 94.780 977 45 4 742 1715 226131493 226130520 0.000000e+00 1517.0
4 TraesCS1B01G431100 chrUn 94.399 982 43 6 742 1719 317129417 317128444 0.000000e+00 1498.0
5 TraesCS1B01G431100 chrUn 93.763 994 50 7 730 1719 323371607 323372592 0.000000e+00 1482.0
6 TraesCS1B01G431100 chrUn 93.793 725 41 2 996 1719 226123206 226122485 0.000000e+00 1086.0
7 TraesCS1B01G431100 chrUn 93.398 621 36 4 1761 2378 226129870 226129252 0.000000e+00 915.0
8 TraesCS1B01G431100 chrUn 91.360 625 46 6 1761 2378 226122484 226121861 0.000000e+00 848.0
9 TraesCS1B01G431100 chrUn 92.120 533 37 4 1761 2288 342054382 342054914 0.000000e+00 747.0
10 TraesCS1B01G431100 chrUn 85.859 594 78 5 1790 2378 226124531 226123939 5.580000e-176 627.0
11 TraesCS1B01G431100 chrUn 100.000 67 0 0 93 159 317129478 317129412 8.920000e-25 124.0
12 TraesCS1B01G431100 chrUn 98.507 67 1 0 93 159 323371558 323371624 4.150000e-23 119.0
13 TraesCS1B01G431100 chr1D 94.954 971 43 4 742 1709 471468603 471469570 0.000000e+00 1517.0
14 TraesCS1B01G431100 chr1D 94.345 725 36 3 996 1719 471555819 471556539 0.000000e+00 1107.0
15 TraesCS1B01G431100 chr1D 93.793 725 41 2 996 1719 471476890 471477611 0.000000e+00 1086.0
16 TraesCS1B01G431100 chr1D 93.398 621 36 4 1761 2378 471470226 471470844 0.000000e+00 915.0
17 TraesCS1B01G431100 chr1D 91.360 625 46 6 1761 2378 471477612 471478235 0.000000e+00 848.0
18 TraesCS1B01G431100 chr1D 92.419 554 34 5 1761 2307 471556540 471557092 0.000000e+00 784.0
19 TraesCS1B01G431100 chr1A 91.608 1001 53 8 730 1719 565580139 565581119 0.000000e+00 1362.0
20 TraesCS1B01G431100 chr1A 95.060 587 18 6 160 742 572743621 572744200 0.000000e+00 913.0
21 TraesCS1B01G431100 chr1A 91.745 533 39 3 1761 2288 565581120 565581652 0.000000e+00 736.0
22 TraesCS1B01G431100 chr1A 100.000 67 0 0 93 159 565580090 565580156 8.920000e-25 124.0
23 TraesCS1B01G431100 chr1A 100.000 42 0 0 701 742 162988013 162988054 7.050000e-11 78.7
24 TraesCS1B01G431100 chr7A 95.904 586 17 5 159 742 79742332 79741752 0.000000e+00 942.0
25 TraesCS1B01G431100 chr7A 84.104 887 118 12 746 1627 44745242 44744374 0.000000e+00 835.0
26 TraesCS1B01G431100 chr7A 93.814 97 6 0 1623 1719 46282541 46282637 1.900000e-31 147.0
27 TraesCS1B01G431100 chr2A 93.867 587 14 6 160 745 28694562 28693997 0.000000e+00 865.0
28 TraesCS1B01G431100 chr6B 88.889 603 44 16 157 743 29887592 29888187 0.000000e+00 721.0
29 TraesCS1B01G431100 chr4B 95.250 400 10 2 345 743 511884799 511884408 2.010000e-175 625.0
30 TraesCS1B01G431100 chr4B 94.737 399 12 2 345 742 511885972 511885582 1.560000e-171 612.0
31 TraesCS1B01G431100 chr4B 92.000 100 7 1 160 259 511886186 511886088 3.190000e-29 139.0
32 TraesCS1B01G431100 chr4B 90.000 100 9 1 160 259 511885019 511884921 6.900000e-26 128.0
33 TraesCS1B01G431100 chr5B 86.141 469 39 17 160 609 315327205 315326744 1.280000e-132 483.0
34 TraesCS1B01G431100 chr5B 96.714 213 5 1 160 372 315328398 315328188 1.050000e-93 353.0
35 TraesCS1B01G431100 chr5B 91.860 86 6 1 1 86 668108729 668108813 4.150000e-23 119.0
36 TraesCS1B01G431100 chr3B 96.512 258 8 1 486 742 115752427 115752684 2.180000e-115 425.0
37 TraesCS1B01G431100 chr3B 96.124 258 9 1 486 742 115753258 115753515 1.020000e-113 420.0
38 TraesCS1B01G431100 chr3B 79.283 251 34 12 218 454 387213904 387213658 2.450000e-35 159.0
39 TraesCS1B01G431100 chr3B 79.878 164 18 7 233 381 770398694 770398857 3.230000e-19 106.0
40 TraesCS1B01G431100 chr3B 90.000 50 4 1 427 475 387232333 387232284 1.970000e-06 63.9
41 TraesCS1B01G431100 chr3A 81.122 196 26 10 160 351 26151314 26151502 1.900000e-31 147.0
42 TraesCS1B01G431100 chr3A 93.023 86 5 1 1 86 27476453 27476537 8.920000e-25 124.0
43 TraesCS1B01G431100 chr3A 93.023 86 5 1 1 86 44308859 44308775 8.920000e-25 124.0
44 TraesCS1B01G431100 chr7B 93.023 86 5 1 1 86 141165915 141165831 8.920000e-25 124.0
45 TraesCS1B01G431100 chr3D 93.023 86 5 1 1 86 6303933 6304017 8.920000e-25 124.0
46 TraesCS1B01G431100 chr3D 91.011 89 6 2 1 88 589427063 589427150 4.150000e-23 119.0
47 TraesCS1B01G431100 chr7D 91.209 91 7 1 1 91 616073464 616073375 3.210000e-24 122.0
48 TraesCS1B01G431100 chr7D 100.000 36 0 0 1761 1796 43793845 43793880 1.530000e-07 67.6
49 TraesCS1B01G431100 chr5A 91.111 90 6 2 1 89 662007387 662007475 1.150000e-23 121.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G431100 chr1B 655594251 655596628 2377 False 4392.000000 4392 100.000000 1 2378 1 chr1B.!!$F1 2377
1 TraesCS1B01G431100 chr1B 655617385 655619096 1711 False 1517.000000 2756 98.229000 1 2299 2 chr1B.!!$F2 2298
2 TraesCS1B01G431100 chrUn 226129252 226131493 2241 True 1216.000000 1517 94.089000 742 2378 2 chrUn.!!$R2 1636
3 TraesCS1B01G431100 chrUn 226121861 226124531 2670 True 853.666667 1086 90.337333 996 2378 3 chrUn.!!$R1 1382
4 TraesCS1B01G431100 chrUn 317128444 317129478 1034 True 811.000000 1498 97.199500 93 1719 2 chrUn.!!$R3 1626
5 TraesCS1B01G431100 chrUn 323371558 323372592 1034 False 800.500000 1482 96.135000 93 1719 2 chrUn.!!$F2 1626
6 TraesCS1B01G431100 chrUn 342054382 342054914 532 False 747.000000 747 92.120000 1761 2288 1 chrUn.!!$F1 527
7 TraesCS1B01G431100 chr1D 471468603 471470844 2241 False 1216.000000 1517 94.176000 742 2378 2 chr1D.!!$F1 1636
8 TraesCS1B01G431100 chr1D 471476890 471478235 1345 False 967.000000 1086 92.576500 996 2378 2 chr1D.!!$F2 1382
9 TraesCS1B01G431100 chr1D 471555819 471557092 1273 False 945.500000 1107 93.382000 996 2307 2 chr1D.!!$F3 1311
10 TraesCS1B01G431100 chr1A 572743621 572744200 579 False 913.000000 913 95.060000 160 742 1 chr1A.!!$F2 582
11 TraesCS1B01G431100 chr1A 565580090 565581652 1562 False 740.666667 1362 94.451000 93 2288 3 chr1A.!!$F3 2195
12 TraesCS1B01G431100 chr7A 79741752 79742332 580 True 942.000000 942 95.904000 159 742 1 chr7A.!!$R2 583
13 TraesCS1B01G431100 chr7A 44744374 44745242 868 True 835.000000 835 84.104000 746 1627 1 chr7A.!!$R1 881
14 TraesCS1B01G431100 chr2A 28693997 28694562 565 True 865.000000 865 93.867000 160 745 1 chr2A.!!$R1 585
15 TraesCS1B01G431100 chr6B 29887592 29888187 595 False 721.000000 721 88.889000 157 743 1 chr6B.!!$F1 586
16 TraesCS1B01G431100 chr4B 511884408 511886186 1778 True 376.000000 625 92.996750 160 743 4 chr4B.!!$R1 583
17 TraesCS1B01G431100 chr5B 315326744 315328398 1654 True 418.000000 483 91.427500 160 609 2 chr5B.!!$R1 449
18 TraesCS1B01G431100 chr3B 115752427 115753515 1088 False 422.500000 425 96.318000 486 742 2 chr3B.!!$F2 256

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
453 2901 0.037975 ACGCCACTAACCCACTAACG 60.038 55.0 0.0 0.0 0.0 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1887 5005 8.602472 TGGGTTGTATTATTAGCATTTTCCTT 57.398 30.769 0.0 0.0 0.0 3.36 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
35 36 2.681848 GCATGCTCTAGTCAATGCAACT 59.318 45.455 11.37 0.00 38.96 3.16
154 155 5.551760 ACATGTTGCATTAGCTGTAGAAC 57.448 39.130 0.00 0.00 42.74 3.01
266 329 4.202060 ACACAAGAACACACACACACAAAA 60.202 37.500 0.00 0.00 0.00 2.44
267 330 4.742167 CACAAGAACACACACACACAAAAA 59.258 37.500 0.00 0.00 0.00 1.94
385 1668 3.756963 GTCGGCCTCTTTTCCATTTACTT 59.243 43.478 0.00 0.00 0.00 2.24
453 2901 0.037975 ACGCCACTAACCCACTAACG 60.038 55.000 0.00 0.00 0.00 3.18
568 3020 4.321718 TCTCCATTATCTAGTACGACCCG 58.678 47.826 0.00 0.00 0.00 5.28
669 3122 3.309682 GCATATGTGTACACGTGAAGCAT 59.690 43.478 27.33 20.25 0.00 3.79
939 3396 7.083062 TCCTTGAATATATGTTGCTCATCCT 57.917 36.000 0.00 0.00 37.91 3.24
1027 3484 0.546122 AACATCGCCCATTCCTGCTA 59.454 50.000 0.00 0.00 0.00 3.49
1048 3505 6.772716 TGCTAACAAAACCAGAGAGAGAAAAT 59.227 34.615 0.00 0.00 0.00 1.82
1098 3555 1.531578 TCGATTGATAGCGAGAGGACG 59.468 52.381 0.00 0.00 37.25 4.79
1731 4844 6.017934 CACTCGACCAATCCTTTTACATATGG 60.018 42.308 7.80 0.00 0.00 2.74
2054 5174 7.355101 TCCACACTAGACCTTCATATTACTCT 58.645 38.462 0.00 0.00 0.00 3.24
2290 5413 4.466827 AGTCGTGGTTAGGATTTTTGGTT 58.533 39.130 0.00 0.00 0.00 3.67
2321 5445 4.215399 TCAAACCTTTCATTAAGCACGAGG 59.785 41.667 0.00 0.00 32.19 4.63
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
35 36 7.119262 GTCTTTTCCATCAGATCGGTCTTTTTA 59.881 37.037 0.00 0.00 30.42 1.52
266 329 2.353579 GGTGCGTGTGTGTAGAGTTTTT 59.646 45.455 0.00 0.00 0.00 1.94
267 330 1.937899 GGTGCGTGTGTGTAGAGTTTT 59.062 47.619 0.00 0.00 0.00 2.43
453 2901 2.860735 CGTGCATGTAGCTAGGAAGTTC 59.139 50.000 0.00 0.00 45.94 3.01
568 3020 3.170360 GGCTGTTAGTTGGGTAGCC 57.830 57.895 3.29 3.29 46.04 3.93
669 3122 1.037493 AGGTGTGCACGTCAGAGTTA 58.963 50.000 13.13 0.00 0.00 2.24
939 3396 1.614903 CAAGATGGGCAAGCAGAAACA 59.385 47.619 0.00 0.00 0.00 2.83
1027 3484 6.607198 TCCAATTTTCTCTCTCTGGTTTTGTT 59.393 34.615 0.00 0.00 0.00 2.83
1048 3505 4.164030 TGCTATTTCATCAGGTAGCTCCAA 59.836 41.667 0.00 0.00 40.07 3.53
1098 3555 2.689983 CCCCACAGAATCATTGCTTACC 59.310 50.000 0.00 0.00 0.00 2.85
1887 5005 8.602472 TGGGTTGTATTATTAGCATTTTCCTT 57.398 30.769 0.00 0.00 0.00 3.36
2321 5445 8.921670 ACAAACAAACTTACAAGACAATGAAAC 58.078 29.630 0.00 0.00 0.00 2.78


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.