Multiple sequence alignment - TraesCS1B01G416400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G416400 chr1B 100.000 2546 0 0 1 2546 641276092 641273547 0.000000e+00 4702
1 TraesCS1B01G416400 chr1B 97.530 2551 49 7 1 2546 640802631 640805172 0.000000e+00 4349
2 TraesCS1B01G416400 chr1B 97.181 2554 61 6 1 2546 599166267 599168817 0.000000e+00 4307
3 TraesCS1B01G416400 chr3D 93.468 2572 122 21 1 2540 543087532 543084975 0.000000e+00 3777
4 TraesCS1B01G416400 chr1D 94.309 2003 80 16 559 2540 464584450 464586439 0.000000e+00 3037
5 TraesCS1B01G416400 chr1D 93.177 513 24 2 1 513 464583869 464584370 0.000000e+00 743
6 TraesCS1B01G416400 chr1A 92.914 2004 107 17 559 2540 556880054 556882044 0.000000e+00 2881
7 TraesCS1B01G416400 chr1A 85.928 867 74 24 1594 2434 557050999 557050155 0.000000e+00 881
8 TraesCS1B01G416400 chr1A 92.788 513 33 3 1 513 556879467 556879975 0.000000e+00 739
9 TraesCS1B01G416400 chr6D 92.762 1644 80 18 919 2540 103932850 103934476 0.000000e+00 2340
10 TraesCS1B01G416400 chr6D 94.152 513 28 1 1 513 103931030 103931540 0.000000e+00 780
11 TraesCS1B01G416400 chr6D 95.785 261 10 1 627 887 103932598 103932857 1.090000e-113 420
12 TraesCS1B01G416400 chr6D 77.932 503 96 13 11 507 457532618 457532125 1.480000e-77 300
13 TraesCS1B01G416400 chr5A 92.406 1646 88 16 919 2540 412189374 412187742 0.000000e+00 2313
14 TraesCS1B01G416400 chr5A 95.652 207 8 1 683 888 412189571 412189365 5.250000e-87 331
15 TraesCS1B01G416400 chr6A 92.326 1642 94 14 919 2540 125300218 125301847 0.000000e+00 2305
16 TraesCS1B01G416400 chr6A 93.774 514 27 4 1 513 125299163 125299672 0.000000e+00 767
17 TraesCS1B01G416400 chr6A 92.857 364 15 2 524 887 125299727 125300079 3.750000e-143 518
18 TraesCS1B01G416400 chr7D 90.925 573 43 6 971 1539 80788194 80787627 0.000000e+00 761
19 TraesCS1B01G416400 chr7D 85.779 443 15 6 526 932 80789210 80788780 2.340000e-115 425
20 TraesCS1B01G416400 chr7B 90.490 347 11 4 596 932 28313238 28312904 3.010000e-119 438
21 TraesCS1B01G416400 chr7A 89.625 347 14 4 596 932 83541221 83540887 3.030000e-114 422
22 TraesCS1B01G416400 chr2A 78.175 504 94 14 11 507 748809835 748810329 8.850000e-80 307


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G416400 chr1B 641273547 641276092 2545 True 4702.000000 4702 100.000000 1 2546 1 chr1B.!!$R1 2545
1 TraesCS1B01G416400 chr1B 640802631 640805172 2541 False 4349.000000 4349 97.530000 1 2546 1 chr1B.!!$F2 2545
2 TraesCS1B01G416400 chr1B 599166267 599168817 2550 False 4307.000000 4307 97.181000 1 2546 1 chr1B.!!$F1 2545
3 TraesCS1B01G416400 chr3D 543084975 543087532 2557 True 3777.000000 3777 93.468000 1 2540 1 chr3D.!!$R1 2539
4 TraesCS1B01G416400 chr1D 464583869 464586439 2570 False 1890.000000 3037 93.743000 1 2540 2 chr1D.!!$F1 2539
5 TraesCS1B01G416400 chr1A 556879467 556882044 2577 False 1810.000000 2881 92.851000 1 2540 2 chr1A.!!$F1 2539
6 TraesCS1B01G416400 chr1A 557050155 557050999 844 True 881.000000 881 85.928000 1594 2434 1 chr1A.!!$R1 840
7 TraesCS1B01G416400 chr6D 103931030 103934476 3446 False 1180.000000 2340 94.233000 1 2540 3 chr6D.!!$F1 2539
8 TraesCS1B01G416400 chr5A 412187742 412189571 1829 True 1322.000000 2313 94.029000 683 2540 2 chr5A.!!$R1 1857
9 TraesCS1B01G416400 chr6A 125299163 125301847 2684 False 1196.666667 2305 92.985667 1 2540 3 chr6A.!!$F1 2539
10 TraesCS1B01G416400 chr7D 80787627 80789210 1583 True 593.000000 761 88.352000 526 1539 2 chr7D.!!$R1 1013

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
798 1821 1.149101 TGGGAGAAGGCTTCAGGTTT 58.851 50.0 27.7 7.84 0.0 3.27 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1694 3458 1.839424 CTTCATTCAACTGGGTCCCC 58.161 55.0 5.13 0.0 0.0 4.81 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
33 34 9.911788 ACTTGTTCTGTGGATTATGAGATATTT 57.088 29.630 0.00 0.00 0.00 1.40
356 358 7.136289 TGACCCAAATTTCACGTTAGATTAC 57.864 36.000 0.00 0.00 0.00 1.89
798 1821 1.149101 TGGGAGAAGGCTTCAGGTTT 58.851 50.000 27.70 7.84 0.00 3.27
839 1863 4.114073 CAAAAAGCTGACAAATGCACAGA 58.886 39.130 5.51 0.00 34.07 3.41
943 1967 3.955524 TGGTTTCCACTTTCCAGGTTA 57.044 42.857 0.00 0.00 0.00 2.85
1385 3141 5.308825 ACTGGTCAACCAACTATTTCTGAG 58.691 41.667 3.03 0.00 46.97 3.35
1444 3200 5.518848 TCTTGCAATTATGGCATAACTGG 57.481 39.130 24.88 16.74 41.58 4.00
1544 3300 4.058817 AGGACAAAAGCGTCTAGTTTCTG 58.941 43.478 0.00 0.00 36.12 3.02
1572 3336 1.726853 AATCGCTCCAGTTTTCCTCG 58.273 50.000 0.00 0.00 0.00 4.63
1687 3451 3.340928 CATGAGTTCCTTGCTGACATGA 58.659 45.455 0.00 0.00 36.70 3.07
1951 3724 4.780815 TCAATCTTTCCAACTCACACTGT 58.219 39.130 0.00 0.00 0.00 3.55
1958 3731 5.801531 TTCCAACTCACACTGTACTGTAT 57.198 39.130 4.96 0.00 0.00 2.29
2398 4202 2.721090 GTCAAGTTGATGTTTCGCTTGC 59.279 45.455 9.18 0.00 37.37 4.01
2412 4216 2.168313 TCGCTTGCTGTTATCATCCTCA 59.832 45.455 0.00 0.00 0.00 3.86
2438 4242 5.779529 AGTTGATGCTTTGTGATTTGAGT 57.220 34.783 0.00 0.00 0.00 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
33 34 6.784473 ACTCATCATGATCACCTATTAGACCA 59.216 38.462 4.86 0.00 0.00 4.02
48 49 7.954666 TCCACCGATATAATACTCATCATGA 57.045 36.000 0.00 0.00 0.00 3.07
175 176 8.102676 TCTTCTGAAGATCACAATCACCAAATA 58.897 33.333 15.82 0.00 34.07 1.40
356 358 7.806690 TCAACTAAAATTCACCTGAAATCTCG 58.193 34.615 0.00 0.00 37.61 4.04
387 389 4.104383 TCTTTGACTGCCTCCTCAAAAT 57.896 40.909 0.00 0.00 36.26 1.82
798 1821 7.867403 GCTTTTTGTACTTGATTGATTCCTCAA 59.133 33.333 0.00 0.00 45.15 3.02
943 1967 7.775561 CCAAGGAACCAGTTAATATTCTAGCTT 59.224 37.037 0.00 0.00 0.00 3.74
1194 2950 0.464036 GACACATATGGCTCGGTGGA 59.536 55.000 7.80 0.00 35.62 4.02
1444 3200 3.057946 GTCTTCCAAGTTGTGATGCTTCC 60.058 47.826 1.45 0.00 0.00 3.46
1687 3451 2.169810 AACTGGGTCCCCATGGCTT 61.170 57.895 6.09 0.00 46.15 4.35
1694 3458 1.839424 CTTCATTCAACTGGGTCCCC 58.161 55.000 5.13 0.00 0.00 4.81
1805 3571 8.346782 ACAGAATTGTGCACTGAAATTCAGCA 62.347 38.462 28.63 13.62 41.20 4.41
2048 3824 6.607735 ATTTGCCAAAAACAACAGAATCAG 57.392 33.333 0.00 0.00 0.00 2.90
2412 4216 7.392673 ACTCAAATCACAAAGCATCAACTAGAT 59.607 33.333 0.00 0.00 37.48 1.98


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.