Multiple sequence alignment - TraesCS1B01G413200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G413200 chr1B 100.000 2797 0 0 1 2797 638749964 638747168 0 5166
1 TraesCS1B01G413200 chr5A 98.713 2798 33 2 1 2797 73031637 73034432 0 4964
2 TraesCS1B01G413200 chr7A 98.677 2797 31 3 1 2797 60106951 60104161 0 4955
3 TraesCS1B01G413200 chr2B 97.999 2798 53 2 1 2797 500714164 500716959 0 4854
4 TraesCS1B01G413200 chr2B 96.958 2794 81 3 4 2797 751970335 751967546 0 4686
5 TraesCS1B01G413200 chr2B 98.296 2347 35 4 452 2797 357761029 357758687 0 4108
6 TraesCS1B01G413200 chr3B 97.533 2797 67 1 1 2797 575754678 575751884 0 4782
7 TraesCS1B01G413200 chr6B 97.497 2797 67 2 1 2797 388367587 388364794 0 4774
8 TraesCS1B01G413200 chr6B 96.389 2797 90 6 1 2797 626863069 626865854 0 4595
9 TraesCS1B01G413200 chr6B 96.415 2287 81 1 1 2287 588839000 588841285 0 3768


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G413200 chr1B 638747168 638749964 2796 True 5166 5166 100.000 1 2797 1 chr1B.!!$R1 2796
1 TraesCS1B01G413200 chr5A 73031637 73034432 2795 False 4964 4964 98.713 1 2797 1 chr5A.!!$F1 2796
2 TraesCS1B01G413200 chr7A 60104161 60106951 2790 True 4955 4955 98.677 1 2797 1 chr7A.!!$R1 2796
3 TraesCS1B01G413200 chr2B 500714164 500716959 2795 False 4854 4854 97.999 1 2797 1 chr2B.!!$F1 2796
4 TraesCS1B01G413200 chr2B 751967546 751970335 2789 True 4686 4686 96.958 4 2797 1 chr2B.!!$R2 2793
5 TraesCS1B01G413200 chr2B 357758687 357761029 2342 True 4108 4108 98.296 452 2797 1 chr2B.!!$R1 2345
6 TraesCS1B01G413200 chr3B 575751884 575754678 2794 True 4782 4782 97.533 1 2797 1 chr3B.!!$R1 2796
7 TraesCS1B01G413200 chr6B 388364794 388367587 2793 True 4774 4774 97.497 1 2797 1 chr6B.!!$R1 2796
8 TraesCS1B01G413200 chr6B 626863069 626865854 2785 False 4595 4595 96.389 1 2797 1 chr6B.!!$F2 2796
9 TraesCS1B01G413200 chr6B 588839000 588841285 2285 False 3768 3768 96.415 1 2287 1 chr6B.!!$F1 2286

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
342 343 3.319405 TGGATTAGCATCTCGAGGTTCTC 59.681 47.826 13.56 0.0 0.0 2.87 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1894 1898 0.465705 CTGGCTCGGCTGGAATCTAA 59.534 55.0 0.0 0.0 0.0 2.1 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
178 179 8.102047 TCTAATTTTGTAACCCAATCTTCCGTA 58.898 33.333 0.00 0.0 31.81 4.02
342 343 3.319405 TGGATTAGCATCTCGAGGTTCTC 59.681 47.826 13.56 0.0 0.00 2.87
1028 1029 5.536260 TGAATCTCAGAGGCATTCTTATCG 58.464 41.667 11.37 0.0 32.41 2.92
1059 1060 2.580322 TCCAAGTCCATGGCCTATTTCA 59.420 45.455 6.96 0.0 40.46 2.69
1558 1562 7.896383 TTCAAGGAATGGAATATTACCAAGG 57.104 36.000 9.69 0.0 40.93 3.61
1809 1813 4.704965 AGGTATATGAAAGAAGGGAACGC 58.295 43.478 0.00 0.0 0.00 4.84
1894 1898 5.304686 TGTGTTTGGAGAGGTGTAGATTT 57.695 39.130 0.00 0.0 0.00 2.17
2051 2055 3.927142 CGCATTACTTTCTCTTCCGAAGT 59.073 43.478 8.01 0.0 0.00 3.01
2135 2139 2.435805 TCAATCATACTCCAGAGTGGGC 59.564 50.000 10.59 0.0 42.52 5.36
2139 2143 1.278985 CATACTCCAGAGTGGGCACAA 59.721 52.381 10.59 0.0 42.52 3.33
2556 2562 5.994668 GTCTTGGAACTGTGAAGAGAAATCT 59.005 40.000 0.00 0.0 0.00 2.40
2739 2745 6.493189 AAAATAGCTTTTTGGTCCCTTTCA 57.507 33.333 2.74 0.0 30.29 2.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
178 179 2.807967 CGATGTTTGTCCCGCATATCAT 59.192 45.455 0.00 0.00 0.00 2.45
342 343 4.818546 AGACGATTTCTTTATGCCCATCAG 59.181 41.667 0.00 0.00 0.00 2.90
1059 1060 0.035458 CCAAAGCTCCGAGTGAACCT 59.965 55.000 0.00 0.00 0.00 3.50
1558 1562 3.896272 ACTATCCGAAATAGTGGAGGGTC 59.104 47.826 8.96 0.00 37.76 4.46
1699 1703 3.936585 GCTTCAAAGCCAACGTGAA 57.063 47.368 3.27 0.00 46.20 3.18
1809 1813 8.230472 AGCTTTTATTCCTCAATCCACTTATG 57.770 34.615 0.00 0.00 0.00 1.90
1894 1898 0.465705 CTGGCTCGGCTGGAATCTAA 59.534 55.000 0.00 0.00 0.00 2.10
2051 2055 0.599991 ACTGAACTCGAATGTGCGCA 60.600 50.000 5.66 5.66 0.00 6.09
2739 2745 2.959707 GACGATGTCCTAACCTCTGGAT 59.040 50.000 0.00 0.00 34.58 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.