Multiple sequence alignment - TraesCS1B01G413100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G413100 chr1B 100.000 2372 0 0 1 2372 638728835 638731206 0.000000e+00 4381.0
1 TraesCS1B01G413100 chr1B 97.265 2377 59 3 1 2372 135053758 135051383 0.000000e+00 4024.0
2 TraesCS1B01G413100 chr5B 98.821 2374 26 2 1 2372 44989097 44991470 0.000000e+00 4228.0
3 TraesCS1B01G413100 chr5B 98.399 2373 37 1 1 2372 127808630 127811002 0.000000e+00 4170.0
4 TraesCS1B01G413100 chr3B 98.694 2373 30 1 1 2372 201615153 201617525 0.000000e+00 4209.0
5 TraesCS1B01G413100 chr3B 98.842 259 2 1 1353 1610 524468319 524468061 5.970000e-126 460.0
6 TraesCS1B01G413100 chr3B 100.000 63 0 0 1926 1988 21185264 21185202 1.490000e-22 117.0
7 TraesCS1B01G413100 chr2B 97.246 2179 57 3 1 2178 1454223 1452047 0.000000e+00 3688.0
8 TraesCS1B01G413100 chr7B 98.872 1418 15 1 1 1417 662726601 662728018 0.000000e+00 2529.0
9 TraesCS1B01G413100 chr7B 95.279 699 27 3 1674 2372 47246657 47247349 0.000000e+00 1103.0
10 TraesCS1B01G413100 chr3D 98.733 1421 17 1 1 1420 589263329 589261909 0.000000e+00 2523.0
11 TraesCS1B01G413100 chr3A 98.733 1421 17 1 1 1420 66004936 66003516 0.000000e+00 2523.0
12 TraesCS1B01G413100 chr6D 98.663 1421 18 1 1 1420 389245625 389244205 0.000000e+00 2518.0
13 TraesCS1B01G413100 chr2A 97.513 965 23 1 1408 2372 53948986 53948023 0.000000e+00 1648.0
14 TraesCS1B01G413100 chr7A 97.080 137 4 0 1838 1974 659649765 659649901 5.100000e-57 231.0
15 TraesCS1B01G413100 chr4A 96.512 86 3 0 2205 2290 670459470 670459385 2.460000e-30 143.0
16 TraesCS1B01G413100 chr4B 97.619 42 0 1 1866 1906 104460384 104460425 1.180000e-08 71.3
17 TraesCS1B01G413100 chr4D 97.500 40 1 0 2101 2140 123342695 123342734 4.230000e-08 69.4
18 TraesCS1B01G413100 chr4D 97.500 40 1 0 2101 2140 123557148 123557187 4.230000e-08 69.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G413100 chr1B 638728835 638731206 2371 False 4381 4381 100.000 1 2372 1 chr1B.!!$F1 2371
1 TraesCS1B01G413100 chr1B 135051383 135053758 2375 True 4024 4024 97.265 1 2372 1 chr1B.!!$R1 2371
2 TraesCS1B01G413100 chr5B 44989097 44991470 2373 False 4228 4228 98.821 1 2372 1 chr5B.!!$F1 2371
3 TraesCS1B01G413100 chr5B 127808630 127811002 2372 False 4170 4170 98.399 1 2372 1 chr5B.!!$F2 2371
4 TraesCS1B01G413100 chr3B 201615153 201617525 2372 False 4209 4209 98.694 1 2372 1 chr3B.!!$F1 2371
5 TraesCS1B01G413100 chr2B 1452047 1454223 2176 True 3688 3688 97.246 1 2178 1 chr2B.!!$R1 2177
6 TraesCS1B01G413100 chr7B 662726601 662728018 1417 False 2529 2529 98.872 1 1417 1 chr7B.!!$F2 1416
7 TraesCS1B01G413100 chr7B 47246657 47247349 692 False 1103 1103 95.279 1674 2372 1 chr7B.!!$F1 698
8 TraesCS1B01G413100 chr3D 589261909 589263329 1420 True 2523 2523 98.733 1 1420 1 chr3D.!!$R1 1419
9 TraesCS1B01G413100 chr3A 66003516 66004936 1420 True 2523 2523 98.733 1 1420 1 chr3A.!!$R1 1419
10 TraesCS1B01G413100 chr6D 389244205 389245625 1420 True 2518 2518 98.663 1 1420 1 chr6D.!!$R1 1419
11 TraesCS1B01G413100 chr2A 53948023 53948986 963 True 1648 1648 97.513 1408 2372 1 chr2A.!!$R1 964

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
960 966 1.00906 TGGCCTCTATGGTAGAACCCA 59.991 52.381 3.32 0.0 37.5 4.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2266 2273 1.750778 CGGCTATCAAAAAGGGCACAT 59.249 47.619 0.0 0.0 0.0 3.21 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
727 729 5.506649 GGCAATCACTCGTTCTTAAAACCAA 60.507 40.000 0.00 0.0 0.00 3.67
875 877 5.695851 TTGAGATTTTGAGAAGAGTTGCC 57.304 39.130 0.00 0.0 0.00 4.52
960 966 1.009060 TGGCCTCTATGGTAGAACCCA 59.991 52.381 3.32 0.0 37.50 4.51
1006 1012 1.195442 TACCCTGTGGCGGATGTCAA 61.195 55.000 0.00 0.0 33.59 3.18
1183 1189 4.183101 CCTTAACGTTAATGGCGAGGTTA 58.817 43.478 20.39 0.0 0.00 2.85
1660 1667 6.338146 CACTCACTATCCAAAATCGGTAGAA 58.662 40.000 0.00 0.0 0.00 2.10
1849 1856 7.175641 GGAGGAAAGTCTTCATGAAAAAGATGA 59.824 37.037 9.88 0.0 35.35 2.92
2266 2273 4.774660 ACTCGTACTCTGGAGAAGGATA 57.225 45.455 4.49 0.0 34.40 2.59
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
727 729 6.109359 CCCGACTCTTTGATCTTAAGAATGT 58.891 40.000 9.71 0.00 31.67 2.71
875 877 1.272490 TCGTACTGTGCTCTCCAAAGG 59.728 52.381 0.00 0.00 32.71 3.11
937 943 2.504175 GGTTCTACCATAGAGGCCAACA 59.496 50.000 5.01 0.00 43.14 3.33
960 966 2.123077 CTCTCAGGCCTCCCCGAT 60.123 66.667 0.00 0.00 39.21 4.18
1068 1074 5.461032 AACTACCGAATTGGCAAAATTCA 57.539 34.783 18.68 4.57 43.94 2.57
1086 1092 9.987272 ATGAATGTGAAATCATAGATCGAACTA 57.013 29.630 4.76 4.76 34.61 2.24
1183 1189 1.341209 CCGCAAGCCTTTCCTCTTTTT 59.659 47.619 0.00 0.00 0.00 1.94
1431 1438 2.686106 GGAGGGTTGGGTCCGCTA 60.686 66.667 0.00 0.00 0.00 4.26
1660 1667 1.004511 AGCTCCATCTCTTGCTTGCTT 59.995 47.619 0.00 0.00 30.96 3.91
2266 2273 1.750778 CGGCTATCAAAAAGGGCACAT 59.249 47.619 0.00 0.00 0.00 3.21


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.