Multiple sequence alignment - TraesCS1B01G413000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G413000 chr1B 100.000 2945 0 0 1 2945 638719569 638716625 0 5439
1 TraesCS1B01G413000 chr3B 97.760 2946 43 11 1 2945 201605891 201602968 0 5053
2 TraesCS1B01G413000 chr3B 96.204 2582 83 7 1 2571 730355152 730352575 0 4211
3 TraesCS1B01G413000 chr3B 97.189 498 13 1 2448 2945 730352641 730352145 0 841
4 TraesCS1B01G413000 chr5B 98.327 2690 40 4 1 2687 127798273 127795586 0 4713
5 TraesCS1B01G413000 chr5B 95.998 2524 85 9 1 2514 34121817 34124334 0 4087
6 TraesCS1B01G413000 chr2B 97.872 2726 46 5 229 2945 760923918 760926640 0 4702
7 TraesCS1B01G413000 chr6B 96.822 2580 64 10 1 2571 128410966 128413536 0 4294
8 TraesCS1B01G413000 chr6B 96.279 2580 80 9 1 2571 265001178 265003750 0 4218
9 TraesCS1B01G413000 chr6B 98.795 498 5 1 2448 2945 128413470 128413966 0 885
10 TraesCS1B01G413000 chr6B 97.189 498 14 0 2448 2945 265003684 265004181 0 843
11 TraesCS1B01G413000 chr2A 96.696 2512 71 5 1 2503 423420400 423417892 0 4169
12 TraesCS1B01G413000 chr2A 98.677 2192 26 2 1 2189 755521017 755518826 0 3884
13 TraesCS1B01G413000 chr3A 96.000 2525 80 11 1 2514 227631624 227634138 0 4084
14 TraesCS1B01G413000 chrUn 98.859 2191 20 3 1 2187 223715546 223717735 0 3903
15 TraesCS1B01G413000 chr5A 95.455 726 31 2 2221 2945 614335499 614336223 0 1157
16 TraesCS1B01G413000 chr5A 93.655 725 46 0 2221 2945 157780303 157779579 0 1085
17 TraesCS1B01G413000 chr7B 96.787 498 16 0 2448 2945 47163097 47162600 0 832
18 TraesCS1B01G413000 chr1A 96.593 499 15 2 2448 2945 94710859 94711356 0 826


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G413000 chr1B 638716625 638719569 2944 True 5439.0 5439 100.0000 1 2945 1 chr1B.!!$R1 2944
1 TraesCS1B01G413000 chr3B 201602968 201605891 2923 True 5053.0 5053 97.7600 1 2945 1 chr3B.!!$R1 2944
2 TraesCS1B01G413000 chr3B 730352145 730355152 3007 True 2526.0 4211 96.6965 1 2945 2 chr3B.!!$R2 2944
3 TraesCS1B01G413000 chr5B 127795586 127798273 2687 True 4713.0 4713 98.3270 1 2687 1 chr5B.!!$R1 2686
4 TraesCS1B01G413000 chr5B 34121817 34124334 2517 False 4087.0 4087 95.9980 1 2514 1 chr5B.!!$F1 2513
5 TraesCS1B01G413000 chr2B 760923918 760926640 2722 False 4702.0 4702 97.8720 229 2945 1 chr2B.!!$F1 2716
6 TraesCS1B01G413000 chr6B 128410966 128413966 3000 False 2589.5 4294 97.8085 1 2945 2 chr6B.!!$F1 2944
7 TraesCS1B01G413000 chr6B 265001178 265004181 3003 False 2530.5 4218 96.7340 1 2945 2 chr6B.!!$F2 2944
8 TraesCS1B01G413000 chr2A 423417892 423420400 2508 True 4169.0 4169 96.6960 1 2503 1 chr2A.!!$R1 2502
9 TraesCS1B01G413000 chr2A 755518826 755521017 2191 True 3884.0 3884 98.6770 1 2189 1 chr2A.!!$R2 2188
10 TraesCS1B01G413000 chr3A 227631624 227634138 2514 False 4084.0 4084 96.0000 1 2514 1 chr3A.!!$F1 2513
11 TraesCS1B01G413000 chrUn 223715546 223717735 2189 False 3903.0 3903 98.8590 1 2187 1 chrUn.!!$F1 2186
12 TraesCS1B01G413000 chr5A 614335499 614336223 724 False 1157.0 1157 95.4550 2221 2945 1 chr5A.!!$F1 724
13 TraesCS1B01G413000 chr5A 157779579 157780303 724 True 1085.0 1085 93.6550 2221 2945 1 chr5A.!!$R1 724

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
978 983 3.78984 GGGTAAATAAGGGGGAAGAGGAA 59.21 47.826 0.0 0.0 0.0 3.36 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2123 2135 0.178944 TCCTCTTCCAACTCGTCCCA 60.179 55.0 0.0 0.0 0.0 4.37 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
35 36 4.774200 TCTCCATCTCATTTGTCACTCTCA 59.226 41.667 0.00 0.00 0.00 3.27
781 782 4.904154 CGTTCGTTTGAAGCCTTAAGAAAG 59.096 41.667 3.36 0.00 33.98 2.62
978 983 3.789840 GGGTAAATAAGGGGGAAGAGGAA 59.210 47.826 0.00 0.00 0.00 3.36
1366 1371 1.810755 GGGAATTTGTTCGGTGTCTCC 59.189 52.381 0.00 0.00 0.00 3.71
1531 1536 1.346479 TTGGGGTGGTTTCTCCGTGA 61.346 55.000 0.00 0.00 39.52 4.35
1578 1585 5.531122 TTAGTCTCCATCATTTACTCCCG 57.469 43.478 0.00 0.00 0.00 5.14
1829 1837 1.152984 CCCCGCCTCATATTGTGCA 60.153 57.895 0.00 0.00 0.00 4.57
1998 2010 7.881142 TGAACGATTCACAAGGAATATTTTGT 58.119 30.769 0.54 0.54 46.17 2.83
2018 2030 0.038343 TTGCTTTTGGCGGATTGCTC 60.038 50.000 0.00 0.00 45.43 4.26
2039 2051 5.314529 CTCACTACTAGGTTGGATCGGATA 58.685 45.833 0.00 0.00 0.00 2.59
2123 2135 1.750778 CTTTGCCATAACGCCCATTCT 59.249 47.619 0.00 0.00 0.00 2.40
2218 2238 2.699846 CCATAGAAGAAGCTGCTCCTCT 59.300 50.000 1.00 7.90 0.00 3.69
2343 2363 7.389884 GGATAAACTCCTTTCGGTTCTTAAACT 59.610 37.037 0.00 0.00 41.29 2.66
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
35 36 5.705905 GCTTGCCGGTTCCTATTAAGAATAT 59.294 40.000 1.90 0.0 0.00 1.28
51 52 0.676466 TGGTTGTATCTGCTTGCCGG 60.676 55.000 0.00 0.0 0.00 6.13
282 283 4.415332 GGTCTTGCGCTCGTCCGA 62.415 66.667 9.73 0.0 0.00 4.55
1054 1059 9.812347 TGGATAATCTATCAAATGCTGGTTAAT 57.188 29.630 0.00 0.0 36.91 1.40
1531 1536 4.864704 AACGATTTAAGGTGGCATTGTT 57.135 36.364 0.00 0.0 0.00 2.83
1578 1585 3.203716 ACTGGCGCCTACTAAAATAAGC 58.796 45.455 29.70 0.0 0.00 3.09
1976 1987 7.116233 GCAAACAAAATATTCCTTGTGAATCGT 59.884 33.333 6.34 0.0 42.75 3.73
1998 2010 0.392336 AGCAATCCGCCAAAAGCAAA 59.608 45.000 0.00 0.0 44.04 3.68
2018 2030 5.710567 TGATATCCGATCCAACCTAGTAGTG 59.289 44.000 0.00 0.0 0.00 2.74
2039 2051 1.380302 GGTGCCTCCACAGGTTGAT 59.620 57.895 0.00 0.0 43.88 2.57
2123 2135 0.178944 TCCTCTTCCAACTCGTCCCA 60.179 55.000 0.00 0.0 0.00 4.37
2218 2238 2.840203 ATTCCCCTCCCTCCGCTTCA 62.840 60.000 0.00 0.0 0.00 3.02
2343 2363 3.331889 AGCCAGAAAGAGAATTTCCTCCA 59.668 43.478 0.00 0.0 33.76 3.86


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.