Multiple sequence alignment - TraesCS1B01G412900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G412900 chr1B 100.000 3957 0 0 1 3957 638711179 638707223 0.000000e+00 7308
1 TraesCS1B01G412900 chr1B 99.227 3495 25 2 463 3955 668815217 668811723 0.000000e+00 6303
2 TraesCS1B01G412900 chr6B 98.560 3957 52 4 1 3955 307006493 307002540 0.000000e+00 6986
3 TraesCS1B01G412900 chr6B 96.996 3962 109 4 1 3955 613172809 613168851 0.000000e+00 6649
4 TraesCS1B01G412900 chr6B 96.001 3401 92 20 1 3400 264968640 264971997 0.000000e+00 5487
5 TraesCS1B01G412900 chr3A 98.484 3957 44 5 1 3955 633100755 633104697 0.000000e+00 6961
6 TraesCS1B01G412900 chr2B 98.205 3956 68 2 1 3955 391123344 391119391 0.000000e+00 6909
7 TraesCS1B01G412900 chr2B 97.919 913 15 3 1 912 357730892 357731801 0.000000e+00 1578
8 TraesCS1B01G412900 chr2B 97.837 786 15 1 1 786 357240854 357241637 0.000000e+00 1356
9 TraesCS1B01G412900 chr2B 92.742 248 5 5 29 276 357503680 357503446 2.930000e-91 346
10 TraesCS1B01G412900 chr7B 99.039 3747 34 2 211 3955 644457137 644460883 0.000000e+00 6719
11 TraesCS1B01G412900 chr3B 96.092 3966 127 11 1 3955 368877745 368873797 0.000000e+00 6440
12 TraesCS1B01G412900 chrUn 98.630 3504 37 3 463 3955 189401019 189404522 0.000000e+00 6194
13 TraesCS1B01G412900 chr7D 98.574 3506 37 5 463 3955 382058613 382062118 0.000000e+00 6185
14 TraesCS1B01G412900 chr7D 98.545 3505 39 4 463 3955 381965223 381961719 0.000000e+00 6180


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G412900 chr1B 638707223 638711179 3956 True 7308 7308 100.000 1 3957 1 chr1B.!!$R1 3956
1 TraesCS1B01G412900 chr1B 668811723 668815217 3494 True 6303 6303 99.227 463 3955 1 chr1B.!!$R2 3492
2 TraesCS1B01G412900 chr6B 307002540 307006493 3953 True 6986 6986 98.560 1 3955 1 chr6B.!!$R1 3954
3 TraesCS1B01G412900 chr6B 613168851 613172809 3958 True 6649 6649 96.996 1 3955 1 chr6B.!!$R2 3954
4 TraesCS1B01G412900 chr6B 264968640 264971997 3357 False 5487 5487 96.001 1 3400 1 chr6B.!!$F1 3399
5 TraesCS1B01G412900 chr3A 633100755 633104697 3942 False 6961 6961 98.484 1 3955 1 chr3A.!!$F1 3954
6 TraesCS1B01G412900 chr2B 391119391 391123344 3953 True 6909 6909 98.205 1 3955 1 chr2B.!!$R2 3954
7 TraesCS1B01G412900 chr2B 357730892 357731801 909 False 1578 1578 97.919 1 912 1 chr2B.!!$F2 911
8 TraesCS1B01G412900 chr2B 357240854 357241637 783 False 1356 1356 97.837 1 786 1 chr2B.!!$F1 785
9 TraesCS1B01G412900 chr7B 644457137 644460883 3746 False 6719 6719 99.039 211 3955 1 chr7B.!!$F1 3744
10 TraesCS1B01G412900 chr3B 368873797 368877745 3948 True 6440 6440 96.092 1 3955 1 chr3B.!!$R1 3954
11 TraesCS1B01G412900 chrUn 189401019 189404522 3503 False 6194 6194 98.630 463 3955 1 chrUn.!!$F1 3492
12 TraesCS1B01G412900 chr7D 382058613 382062118 3505 False 6185 6185 98.574 463 3955 1 chr7D.!!$F1 3492
13 TraesCS1B01G412900 chr7D 381961719 381965223 3504 True 6180 6180 98.545 463 3955 1 chr7D.!!$R1 3492

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
97 98 4.019174 GACCAATGATCACCCATGACTTT 58.981 43.478 0.0 0.0 37.79 2.66 F
1180 1191 1.133363 TGAGGTTTCTTTCCCGTCCA 58.867 50.000 0.0 0.0 0.00 4.02 F
2104 2115 2.985139 GAGCGTATATAACTTGGGTCGC 59.015 50.000 0.0 0.0 42.15 5.19 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1351 1362 0.107897 CGACCGTGGGGATCAAATGA 60.108 55.000 0.00 0.0 36.97 2.57 R
2305 2316 0.178992 TGGCTACTGCTGTTTTGCCT 60.179 50.000 24.05 0.0 39.59 4.75 R
3192 3213 4.646945 TGAGAGAAAGAGTGTGAGACTTGT 59.353 41.667 0.00 0.0 33.83 3.16 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
97 98 4.019174 GACCAATGATCACCCATGACTTT 58.981 43.478 0.00 0.00 37.79 2.66
98 99 4.419282 ACCAATGATCACCCATGACTTTT 58.581 39.130 0.00 0.00 37.79 2.27
272 273 6.099269 ACTTGACTAAACTAAGGACCTCAACA 59.901 38.462 0.00 0.00 0.00 3.33
1180 1191 1.133363 TGAGGTTTCTTTCCCGTCCA 58.867 50.000 0.00 0.00 0.00 4.02
1351 1362 5.825593 TCACTAGACTTTCCTGAACCATT 57.174 39.130 0.00 0.00 0.00 3.16
1511 1522 8.531530 GTCAGTTACAATGACAAAATTGTTGAC 58.468 33.333 13.37 13.37 46.19 3.18
2057 2068 5.774498 AGAGGGAAGTTTTGTAAAAGCAG 57.226 39.130 0.00 0.00 0.00 4.24
2104 2115 2.985139 GAGCGTATATAACTTGGGTCGC 59.015 50.000 0.00 0.00 42.15 5.19
2305 2316 3.843619 TCATTATTGGGGACAGACAGACA 59.156 43.478 0.00 0.00 44.54 3.41
2485 2496 1.523938 GGCGGATTCACCTGCTACC 60.524 63.158 0.00 0.00 37.93 3.18
3192 3213 1.153568 CTCGAAATGGAGAGCGGCA 60.154 57.895 1.45 0.00 36.08 5.69
3514 3537 4.439968 CAGACTGCTCAAGATTATCTGCA 58.560 43.478 5.75 5.75 0.00 4.41
3955 3978 1.211949 GGATCCAATGAAGAACCGGGA 59.788 52.381 6.95 0.00 0.00 5.14
3956 3979 2.356741 GGATCCAATGAAGAACCGGGAA 60.357 50.000 6.95 0.00 0.00 3.97
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1180 1191 5.767816 AGCTAGAACGGTTTCAATTTGTT 57.232 34.783 0.00 0.0 33.72 2.83
1351 1362 0.107897 CGACCGTGGGGATCAAATGA 60.108 55.000 0.00 0.0 36.97 2.57
1453 1464 2.685897 CTCCGTTCCACTTTGGTTTTCA 59.314 45.455 0.00 0.0 39.03 2.69
1578 1589 9.340695 CGTACTTTCATAATTGAATCAAAAGCA 57.659 29.630 0.00 0.0 41.38 3.91
2057 2068 3.563390 GGTATCTGAGCAATTCTTCCTGC 59.437 47.826 0.00 0.0 38.91 4.85
2104 2115 5.527582 AGGTTTAGCCAGAGCATTTATAACG 59.472 40.000 0.00 0.0 43.56 3.18
2305 2316 0.178992 TGGCTACTGCTGTTTTGCCT 60.179 50.000 24.05 0.0 39.59 4.75
2485 2496 6.084925 CGTATAAGGAGCGAGGTATTGTAAG 58.915 44.000 0.00 0.0 0.00 2.34
3192 3213 4.646945 TGAGAGAAAGAGTGTGAGACTTGT 59.353 41.667 0.00 0.0 33.83 3.16
3417 3440 6.294176 GCATTTGTCATACAACCAAGACTTCT 60.294 38.462 0.00 0.0 37.90 2.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.