Multiple sequence alignment - TraesCS1B01G412800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G412800 chr1B 100.000 2483 0 0 1 2483 638704222 638706704 0.000000e+00 4586.0
1 TraesCS1B01G412800 chr7B 98.913 2484 25 2 1 2483 644463887 644461405 0.000000e+00 4436.0
2 TraesCS1B01G412800 chr7D 98.792 2484 27 3 1 2483 381958718 381961199 0.000000e+00 4418.0
3 TraesCS1B01G412800 chr7D 98.712 2484 29 3 1 2483 382065121 382062640 0.000000e+00 4407.0
4 TraesCS1B01G412800 chr3A 98.709 2478 29 3 7 2483 633107693 633105218 0.000000e+00 4396.0
5 TraesCS1B01G412800 chr3A 97.158 1161 29 3 1324 2483 51829847 51828690 0.000000e+00 1958.0
6 TraesCS1B01G412800 chr3A 96.734 1041 32 2 1 1040 51830894 51829855 0.000000e+00 1733.0
7 TraesCS1B01G412800 chr3A 98.413 63 1 0 1917 1979 108764822 108764884 7.260000e-21 111.0
8 TraesCS1B01G412800 chr2B 97.907 2485 46 5 1 2483 391116389 391118869 0.000000e+00 4296.0
9 TraesCS1B01G412800 chr4A 95.445 2481 103 7 7 2483 295270823 295268349 0.000000e+00 3947.0
10 TraesCS1B01G412800 chr4A 98.077 104 2 0 1758 1861 569955559 569955456 5.460000e-42 182.0
11 TraesCS1B01G412800 chr4A 98.077 52 1 0 1877 1928 63212383 63212332 9.460000e-15 91.6
12 TraesCS1B01G412800 chr5B 94.924 1635 75 7 2 1634 21078544 21076916 0.000000e+00 2553.0
13 TraesCS1B01G412800 chr5B 95.679 810 32 2 1674 2483 21076917 21076111 0.000000e+00 1299.0
14 TraesCS1B01G412800 chr5B 95.614 228 7 2 1488 1715 393363955 393364179 1.820000e-96 363.0
15 TraesCS1B01G412800 chr2A 97.640 1229 28 1 1 1228 332947833 332949061 0.000000e+00 2108.0
16 TraesCS1B01G412800 chr2A 98.636 220 3 0 1304 1523 546998921 546999140 8.330000e-105 390.0
17 TraesCS1B01G412800 chr2A 95.794 214 6 2 1986 2199 431620832 431621042 2.360000e-90 342.0
18 TraesCS1B01G412800 chr2A 94.681 94 5 0 1222 1315 332949145 332949052 1.990000e-31 147.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G412800 chr1B 638704222 638706704 2482 False 4586.0 4586 100.0000 1 2483 1 chr1B.!!$F1 2482
1 TraesCS1B01G412800 chr7B 644461405 644463887 2482 True 4436.0 4436 98.9130 1 2483 1 chr7B.!!$R1 2482
2 TraesCS1B01G412800 chr7D 381958718 381961199 2481 False 4418.0 4418 98.7920 1 2483 1 chr7D.!!$F1 2482
3 TraesCS1B01G412800 chr7D 382062640 382065121 2481 True 4407.0 4407 98.7120 1 2483 1 chr7D.!!$R1 2482
4 TraesCS1B01G412800 chr3A 633105218 633107693 2475 True 4396.0 4396 98.7090 7 2483 1 chr3A.!!$R1 2476
5 TraesCS1B01G412800 chr3A 51828690 51830894 2204 True 1845.5 1958 96.9460 1 2483 2 chr3A.!!$R2 2482
6 TraesCS1B01G412800 chr2B 391116389 391118869 2480 False 4296.0 4296 97.9070 1 2483 1 chr2B.!!$F1 2482
7 TraesCS1B01G412800 chr4A 295268349 295270823 2474 True 3947.0 3947 95.4450 7 2483 1 chr4A.!!$R2 2476
8 TraesCS1B01G412800 chr5B 21076111 21078544 2433 True 1926.0 2553 95.3015 2 2483 2 chr5B.!!$R1 2481
9 TraesCS1B01G412800 chr2A 332947833 332949061 1228 False 2108.0 2108 97.6400 1 1228 1 chr2A.!!$F1 1227

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
876 878 1.153489 GCATCCAGCAGAGCGAAGA 60.153 57.895 0.0 0.0 44.79 2.87 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1923 1930 1.541588 GCATTTTCTCTTCCTTGCCGT 59.458 47.619 0.0 0.0 0.0 5.68 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
472 474 5.446741 GGCATAAAAGACGCATTTTCTACGA 60.447 40.000 1.81 0.0 34.35 3.43
533 535 2.113139 CCACCAACTTCCTGGCGT 59.887 61.111 0.00 0.0 40.45 5.68
876 878 1.153489 GCATCCAGCAGAGCGAAGA 60.153 57.895 0.00 0.0 44.79 2.87
1297 1302 4.161189 TCATTTTCAAAACAGGGTCAAGCA 59.839 37.500 0.00 0.0 0.00 3.91
1612 1618 3.588842 AGACCATGTCCCTGAGATTTGAA 59.411 43.478 0.00 0.0 32.18 2.69
1777 1784 2.034053 GTGAATGCAACGAAAAGACCCA 59.966 45.455 0.00 0.0 0.00 4.51
1923 1930 9.376075 GATCTTTTTGATATGTCTCAGTCTCAA 57.624 33.333 0.00 0.0 35.14 3.02
2229 2236 8.292448 GTCATTTAGCTTCAATTTCTTCAGTCA 58.708 33.333 0.00 0.0 0.00 3.41
2318 2325 7.154191 AGGATAAGGAAATTGGATAAGAGCA 57.846 36.000 0.00 0.0 0.00 4.26
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
446 448 5.391312 AGAAAATGCGTCTTTTATGCCTT 57.609 34.783 0.00 0.0 39.57 4.35
472 474 1.299976 GCTGGTGGTTTCGGGATCT 59.700 57.895 0.00 0.0 0.00 2.75
876 878 1.068541 GCCGAAAAGAATGGAACGCTT 60.069 47.619 0.00 0.0 0.00 4.68
1297 1302 0.532115 CCAGCCCTTTTTAATGCGCT 59.468 50.000 9.73 0.0 0.00 5.92
1672 1679 3.211045 CTTTCCTTGGTCTTTCGTTCCA 58.789 45.455 0.00 0.0 0.00 3.53
1731 1738 1.846007 ACAAGAAACAACCACCAGCA 58.154 45.000 0.00 0.0 0.00 4.41
1818 1825 8.480501 ACTAAGCATAAATTTGGAAATGAGCAT 58.519 29.630 0.00 0.0 0.00 3.79
1923 1930 1.541588 GCATTTTCTCTTCCTTGCCGT 59.458 47.619 0.00 0.0 0.00 5.68
2245 2252 8.611757 AGGAAAATACAATTTCTTTTGTTGCAC 58.388 29.630 0.00 0.0 40.25 4.57
2318 2325 3.235200 ACCAACAGTCAGTCTAGCTCTT 58.765 45.455 0.00 0.0 0.00 2.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.