Multiple sequence alignment - TraesCS1B01G412700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G412700 chr1B 100.000 2255 0 0 1 2255 638702482 638700228 0 4165
1 TraesCS1B01G412700 chr1B 98.537 2256 31 2 1 2255 672477345 672479599 0 3982
2 TraesCS1B01G412700 chr1D 98.980 2256 20 3 1 2255 141314951 141312698 0 4036
3 TraesCS1B01G412700 chr7B 98.892 2257 22 3 1 2255 644465627 644467882 0 4026
4 TraesCS1B01G412700 chr7A 98.848 2256 24 2 1 2255 60150103 60147849 0 4021
5 TraesCS1B01G412700 chr7A 97.737 2254 48 3 3 2255 46399060 46396809 0 3877
6 TraesCS1B01G412700 chr3A 98.803 2256 25 2 1 2255 633109438 633111692 0 4015
7 TraesCS1B01G412700 chr6B 98.493 2256 32 2 1 2255 306997806 306995552 0 3976
8 TraesCS1B01G412700 chr6B 97.074 2256 64 2 1 2255 613164120 613161866 0 3799
9 TraesCS1B01G412700 chr4B 98.449 2256 32 3 1 2255 209079333 209077080 0 3969


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G412700 chr1B 638700228 638702482 2254 True 4165 4165 100.000 1 2255 1 chr1B.!!$R1 2254
1 TraesCS1B01G412700 chr1B 672477345 672479599 2254 False 3982 3982 98.537 1 2255 1 chr1B.!!$F1 2254
2 TraesCS1B01G412700 chr1D 141312698 141314951 2253 True 4036 4036 98.980 1 2255 1 chr1D.!!$R1 2254
3 TraesCS1B01G412700 chr7B 644465627 644467882 2255 False 4026 4026 98.892 1 2255 1 chr7B.!!$F1 2254
4 TraesCS1B01G412700 chr7A 60147849 60150103 2254 True 4021 4021 98.848 1 2255 1 chr7A.!!$R2 2254
5 TraesCS1B01G412700 chr7A 46396809 46399060 2251 True 3877 3877 97.737 3 2255 1 chr7A.!!$R1 2252
6 TraesCS1B01G412700 chr3A 633109438 633111692 2254 False 4015 4015 98.803 1 2255 1 chr3A.!!$F1 2254
7 TraesCS1B01G412700 chr6B 306995552 306997806 2254 True 3976 3976 98.493 1 2255 1 chr6B.!!$R1 2254
8 TraesCS1B01G412700 chr6B 613161866 613164120 2254 True 3799 3799 97.074 1 2255 1 chr6B.!!$R2 2254
9 TraesCS1B01G412700 chr4B 209077080 209079333 2253 True 3969 3969 98.449 1 2255 1 chr4B.!!$R1 2254

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
486 487 1.275856 CAGAGCTGCAAGGAGAGACTT 59.724 52.381 1.02 0.0 0.0 3.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1901 1903 0.741326 TCATTCCGAAGAGCCGAGAG 59.259 55.0 0.0 0.0 0.0 3.2 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
293 294 3.704061 CCTAGGTCTTCCTCTTCCTTCTG 59.296 52.174 0.00 0.0 43.94 3.02
454 455 4.081406 AGGAGCAGTTATTTGCAATGACA 58.919 39.130 0.00 0.0 46.47 3.58
486 487 1.275856 CAGAGCTGCAAGGAGAGACTT 59.724 52.381 1.02 0.0 0.00 3.01
590 591 8.376270 AGCTTTGTACTTGAAATTAGTAGTCCT 58.624 33.333 0.00 0.0 0.00 3.85
1098 1100 7.013834 TCCCTTGGTATTCAGGTTGTAAAATT 58.986 34.615 0.00 0.0 0.00 1.82
1580 1582 7.998964 AGAAAAAGGTTTGAAGGTTGATCTCTA 59.001 33.333 0.00 0.0 0.00 2.43
1751 1753 5.045942 TGAGCGAGACTCTATCCAGATCTAT 60.046 44.000 0.00 0.0 46.41 1.98
1901 1903 6.037281 AGCTAGCTAATTTTTCCTTTACGAGC 59.963 38.462 17.69 0.0 0.00 5.03
2091 2094 8.760980 TTAAATGAAGAAAGAAAGAAGGGTCA 57.239 30.769 0.00 0.0 0.00 4.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
21 22 5.074115 AGAAGAAGATAGATAGGTCCACGG 58.926 45.833 0.00 0.0 0.00 4.94
113 114 1.149101 AGGAAGGGCTGAAACAAGGA 58.851 50.000 0.00 0.0 0.00 3.36
454 455 0.617413 CAGCTCTGACCAATCCACCT 59.383 55.000 0.00 0.0 0.00 4.00
486 487 2.479837 CTCTTTATCGCGCCATAACCA 58.520 47.619 6.98 0.0 0.00 3.67
1098 1100 7.013083 GGTATAACAGTCGACTTTCCTATCAGA 59.987 40.741 17.26 0.0 0.00 3.27
1580 1582 3.385111 GGTTCCGAACTATCACTGATCCT 59.615 47.826 11.03 0.0 0.00 3.24
1751 1753 2.479730 GCTCGCGGAGTTCTTAGATCAA 60.480 50.000 6.13 0.0 31.39 2.57
1828 1830 1.201429 TCAGTGAAGGAAGGGAGCCC 61.201 60.000 0.00 0.0 0.00 5.19
1901 1903 0.741326 TCATTCCGAAGAGCCGAGAG 59.259 55.000 0.00 0.0 0.00 3.20
2044 2047 2.023760 AAGGGGGAGCAAAGCCTGTT 62.024 55.000 0.00 0.0 0.00 3.16
2091 2094 3.470645 ACTGTGAGCGGTCTAAACTTT 57.529 42.857 16.64 0.0 0.00 2.66


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.