Multiple sequence alignment - TraesCS1B01G412600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G412600 chr1B 100.000 2360 0 0 1 2360 638698025 638695666 0 4359
1 TraesCS1B01G412600 chr7D 98.729 2360 29 1 1 2360 203518117 203520475 0 4191
2 TraesCS1B01G412600 chr7B 98.686 2360 31 0 1 2360 644470082 644472441 0 4187
3 TraesCS1B01G412600 chr7A 98.559 2360 34 0 1 2360 60120927 60118568 0 4170
4 TraesCS1B01G412600 chr7A 98.093 2360 44 1 1 2360 63429290 63431648 0 4108
5 TraesCS1B01G412600 chr7A 98.008 2360 45 1 1 2360 211272569 211270212 0 4096
6 TraesCS1B01G412600 chr7A 97.627 2360 56 0 1 2360 46394305 46391946 0 4048
7 TraesCS1B01G412600 chr3A 98.305 2360 38 1 1 2360 633113889 633116246 0 4135
8 TraesCS1B01G412600 chr6B 98.093 2360 43 2 1 2360 306993349 306990992 0 4108


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G412600 chr1B 638695666 638698025 2359 True 4359 4359 100.000 1 2360 1 chr1B.!!$R1 2359
1 TraesCS1B01G412600 chr7D 203518117 203520475 2358 False 4191 4191 98.729 1 2360 1 chr7D.!!$F1 2359
2 TraesCS1B01G412600 chr7B 644470082 644472441 2359 False 4187 4187 98.686 1 2360 1 chr7B.!!$F1 2359
3 TraesCS1B01G412600 chr7A 60118568 60120927 2359 True 4170 4170 98.559 1 2360 1 chr7A.!!$R2 2359
4 TraesCS1B01G412600 chr7A 63429290 63431648 2358 False 4108 4108 98.093 1 2360 1 chr7A.!!$F1 2359
5 TraesCS1B01G412600 chr7A 211270212 211272569 2357 True 4096 4096 98.008 1 2360 1 chr7A.!!$R3 2359
6 TraesCS1B01G412600 chr7A 46391946 46394305 2359 True 4048 4048 97.627 1 2360 1 chr7A.!!$R1 2359
7 TraesCS1B01G412600 chr3A 633113889 633116246 2357 False 4135 4135 98.305 1 2360 1 chr3A.!!$F1 2359
8 TraesCS1B01G412600 chr6B 306990992 306993349 2357 True 4108 4108 98.093 1 2360 1 chr6B.!!$R1 2359

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
222 223 1.070914 GGTTGGCTGCCTATCCTAGAC 59.929 57.143 21.03 5.54 0.0 2.59 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1705 1708 0.980231 TTTTGCTGGCAACCCCTGTT 60.98 50.0 7.56 0.0 35.46 3.16 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
222 223 1.070914 GGTTGGCTGCCTATCCTAGAC 59.929 57.143 21.03 5.54 0.00 2.59
863 864 3.296854 TGTAGGGATTAGTGCGTGAGAT 58.703 45.455 0.00 0.00 0.00 2.75
1105 1106 0.390124 GTACGTTGTCACACTCCCCA 59.610 55.000 0.00 0.00 0.00 4.96
1113 1114 1.925455 CACACTCCCCACCCTCCAT 60.925 63.158 0.00 0.00 0.00 3.41
1344 1345 3.198872 GGTAAGGGATCTCTTTTCTGCG 58.801 50.000 14.35 0.00 0.00 5.18
1486 1489 8.624776 GCTAGTGTCAATAAAAAGGCTAATGAT 58.375 33.333 0.00 0.00 0.00 2.45
1705 1708 6.194235 AGCCTCCCAAATCAAACATACATTA 58.806 36.000 0.00 0.00 0.00 1.90
1719 1722 1.923356 ACATTAACAGGGGTTGCCAG 58.077 50.000 0.00 0.00 37.88 4.85
1842 1845 3.140325 GGAACCCTGAACAACATCTCA 57.860 47.619 0.00 0.00 0.00 3.27
2008 2011 1.539388 ACTTTCAATGCGCGAAATCCA 59.461 42.857 12.10 0.00 32.21 3.41
2154 2159 2.983296 AGATTCCATTCCCTCGATCCT 58.017 47.619 0.00 0.00 0.00 3.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
157 158 1.622607 CCGGGTGAGTAGGGATGCAA 61.623 60.000 0.00 0.00 0.00 4.08
222 223 4.080919 GGGATCTTTTTGGAAATGGGAAGG 60.081 45.833 0.00 0.00 0.00 3.46
334 335 2.510382 TCCGGCCAAGTCCCATTAATTA 59.490 45.455 2.24 0.00 0.00 1.40
863 864 1.006825 CGTCAGTTTGTGGATCGCGA 61.007 55.000 13.09 13.09 0.00 5.87
1113 1114 1.229359 CCCGTCCTCTAGGCACCTA 59.771 63.158 0.00 0.00 34.44 3.08
1486 1489 7.558444 GGAGTAAAGGAGATTGACTCTTCTCTA 59.442 40.741 5.35 0.00 39.07 2.43
1705 1708 0.980231 TTTTGCTGGCAACCCCTGTT 60.980 50.000 7.56 0.00 35.46 3.16
1719 1722 2.230025 GGCCTCTTTCCTCTCTTTTTGC 59.770 50.000 0.00 0.00 0.00 3.68
1838 1841 4.431416 TGTAGCTTTGAAAAGGGTGAGA 57.569 40.909 0.00 0.00 33.46 3.27
1842 1845 2.228822 CGCATGTAGCTTTGAAAAGGGT 59.771 45.455 0.00 0.00 42.61 4.34
1939 1942 6.072119 CGCCCTTCCTTTAAGTTTCAGTATTT 60.072 38.462 0.00 0.00 32.89 1.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.