Multiple sequence alignment - TraesCS1B01G412400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G412400 chr1B 100.000 2531 0 0 1 2531 638370823 638368293 0 4674
1 TraesCS1B01G412400 chr1B 98.462 2535 33 4 1 2531 638213646 638211114 0 4460
2 TraesCS1B01G412400 chr1B 98.749 2159 26 1 1 2158 638295086 638292928 0 3836
3 TraesCS1B01G412400 chr1B 94.507 619 20 9 1858 2468 7242455 7241843 0 942
4 TraesCS1B01G412400 chr1B 94.004 567 33 1 1 566 539599055 539599621 0 857
5 TraesCS1B01G412400 chrUn 98.619 2535 30 3 1 2531 7969475 7966942 0 4482
6 TraesCS1B01G412400 chrUn 95.289 1974 63 8 563 2531 2822312 2820364 0 3103
7 TraesCS1B01G412400 chrUn 95.871 1429 39 5 1106 2531 275942709 275944120 0 2294
8 TraesCS1B01G412400 chr6B 97.087 1991 41 7 557 2531 48431702 48429713 0 3339
9 TraesCS1B01G412400 chr6B 94.346 566 31 1 1 565 693912343 693912908 0 867
10 TraesCS1B01G412400 chr5B 97.008 1972 54 3 564 2531 593500286 593498316 0 3310
11 TraesCS1B01G412400 chr5B 96.701 1970 51 4 564 2531 571605636 571603679 0 3265
12 TraesCS1B01G412400 chr5B 95.062 567 26 2 1 565 43800788 43801354 0 891
13 TraesCS1B01G412400 chr5B 95.062 567 26 2 1 565 43812404 43812970 0 891
14 TraesCS1B01G412400 chr4B 96.628 1987 48 8 561 2531 628665910 628667893 0 3280
15 TraesCS1B01G412400 chr7B 96.665 1979 41 13 563 2531 684309170 684311133 0 3265
16 TraesCS1B01G412400 chr7B 95.736 1970 42 4 564 2531 697603941 697602012 0 3134
17 TraesCS1B01G412400 chr7B 95.230 566 26 1 1 565 43756542 43755977 0 894
18 TraesCS1B01G412400 chr3B 96.044 1997 34 16 564 2531 31297187 31299167 0 3208
19 TraesCS1B01G412400 chr7A 94.523 566 30 1 1 565 161722802 161723367 0 872


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G412400 chr1B 638368293 638370823 2530 True 4674 4674 100.000 1 2531 1 chr1B.!!$R4 2530
1 TraesCS1B01G412400 chr1B 638211114 638213646 2532 True 4460 4460 98.462 1 2531 1 chr1B.!!$R2 2530
2 TraesCS1B01G412400 chr1B 638292928 638295086 2158 True 3836 3836 98.749 1 2158 1 chr1B.!!$R3 2157
3 TraesCS1B01G412400 chr1B 7241843 7242455 612 True 942 942 94.507 1858 2468 1 chr1B.!!$R1 610
4 TraesCS1B01G412400 chr1B 539599055 539599621 566 False 857 857 94.004 1 566 1 chr1B.!!$F1 565
5 TraesCS1B01G412400 chrUn 7966942 7969475 2533 True 4482 4482 98.619 1 2531 1 chrUn.!!$R2 2530
6 TraesCS1B01G412400 chrUn 2820364 2822312 1948 True 3103 3103 95.289 563 2531 1 chrUn.!!$R1 1968
7 TraesCS1B01G412400 chrUn 275942709 275944120 1411 False 2294 2294 95.871 1106 2531 1 chrUn.!!$F1 1425
8 TraesCS1B01G412400 chr6B 48429713 48431702 1989 True 3339 3339 97.087 557 2531 1 chr6B.!!$R1 1974
9 TraesCS1B01G412400 chr6B 693912343 693912908 565 False 867 867 94.346 1 565 1 chr6B.!!$F1 564
10 TraesCS1B01G412400 chr5B 593498316 593500286 1970 True 3310 3310 97.008 564 2531 1 chr5B.!!$R2 1967
11 TraesCS1B01G412400 chr5B 571603679 571605636 1957 True 3265 3265 96.701 564 2531 1 chr5B.!!$R1 1967
12 TraesCS1B01G412400 chr5B 43800788 43801354 566 False 891 891 95.062 1 565 1 chr5B.!!$F1 564
13 TraesCS1B01G412400 chr5B 43812404 43812970 566 False 891 891 95.062 1 565 1 chr5B.!!$F2 564
14 TraesCS1B01G412400 chr4B 628665910 628667893 1983 False 3280 3280 96.628 561 2531 1 chr4B.!!$F1 1970
15 TraesCS1B01G412400 chr7B 684309170 684311133 1963 False 3265 3265 96.665 563 2531 1 chr7B.!!$F1 1968
16 TraesCS1B01G412400 chr7B 697602012 697603941 1929 True 3134 3134 95.736 564 2531 1 chr7B.!!$R2 1967
17 TraesCS1B01G412400 chr7B 43755977 43756542 565 True 894 894 95.230 1 565 1 chr7B.!!$R1 564
18 TraesCS1B01G412400 chr3B 31297187 31299167 1980 False 3208 3208 96.044 564 2531 1 chr3B.!!$F1 1967
19 TraesCS1B01G412400 chr7A 161722802 161723367 565 False 872 872 94.523 1 565 1 chr7A.!!$F1 564

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
756 761 1.445582 GACCCACCAGTTACTCGCG 60.446 63.158 0.0 0.0 0.0 5.87 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1770 1792 1.388547 GCCCAACATCTATTCGGCAA 58.611 50.0 0.0 0.0 36.02 4.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
756 761 1.445582 GACCCACCAGTTACTCGCG 60.446 63.158 0.00 0.00 0.00 5.87
1011 1028 4.845580 CCGCGCATGGAGCCTCTT 62.846 66.667 8.75 0.00 41.38 2.85
1159 1176 3.832490 CCCGATTTCTTTCCTTTTCCCTT 59.168 43.478 0.00 0.00 0.00 3.95
1574 1591 1.280457 AGTCAGCTAGTTTCAGGGGG 58.720 55.000 0.00 0.00 0.00 5.40
1959 1981 8.715191 TTTTCTTGCACTAAATTTTGTGATGT 57.285 26.923 29.06 4.46 36.27 3.06
2255 2326 8.746530 CCCATAGCAATCTTCAAATAATAGCAT 58.253 33.333 0.00 0.00 0.00 3.79
2299 2376 3.951037 AGCATAACGATTGCAACCCATAA 59.049 39.130 0.00 0.00 42.62 1.90
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1011 1028 2.869801 CCTCACACAAGTCAAACGCTTA 59.130 45.455 0.00 0.0 0.00 3.09
1159 1176 1.140852 CAGATCCACCGCCCTAATTCA 59.859 52.381 0.00 0.0 0.00 2.57
1326 1343 2.644992 GCTTGTTCCACGGCAAGG 59.355 61.111 6.45 0.0 41.54 3.61
1770 1792 1.388547 GCCCAACATCTATTCGGCAA 58.611 50.000 0.00 0.0 36.02 4.52
1925 1947 3.843893 AGTGCAAGAAAAAGGCCAAAT 57.156 38.095 5.01 0.0 0.00 2.32
2299 2376 5.046159 TGGAGTTGTAAGGTTATCGTGGAAT 60.046 40.000 0.00 0.0 0.00 3.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.