Multiple sequence alignment - TraesCS1B01G412300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G412300 chr1B 100.000 2300 0 0 1 2300 638091127 638088828 0.000000e+00 4248
1 TraesCS1B01G412300 chr1B 97.713 2143 47 2 1 2142 638114107 638111966 0.000000e+00 3685
2 TraesCS1B01G412300 chr1B 94.817 1640 77 5 1 1632 638339955 638338316 0.000000e+00 2551
3 TraesCS1B01G412300 chr1B 94.329 1640 85 5 1 1632 638157613 638155974 0.000000e+00 2507
4 TraesCS1B01G412300 chr1B 98.111 1429 25 2 1 1428 638117714 638116287 0.000000e+00 2488
5 TraesCS1B01G412300 chr1B 94.085 1640 89 5 1 1632 638251069 638249430 0.000000e+00 2484
6 TraesCS1B01G412300 chr1B 88.416 846 71 13 1029 1866 549451875 549451049 0.000000e+00 994
7 TraesCS1B01G412300 chr1B 96.575 584 18 2 1718 2300 638116276 638115694 0.000000e+00 966
8 TraesCS1B01G412300 chr1B 94.226 433 20 3 1868 2300 348919027 348919454 0.000000e+00 656
9 TraesCS1B01G412300 chr1B 86.344 227 15 5 1657 1867 638155990 638155764 1.370000e-57 233
10 TraesCS1B01G412300 chrUn 97.001 2301 59 4 1 2300 7838351 7836060 0.000000e+00 3858
11 TraesCS1B01G412300 chrUn 97.680 2155 48 2 1 2154 340566715 340564562 0.000000e+00 3701
12 TraesCS1B01G412300 chrUn 92.283 1879 106 20 1 1867 7872929 7871078 0.000000e+00 2630
13 TraesCS1B01G412300 chrUn 94.207 1640 87 5 1 1632 7925478 7923839 0.000000e+00 2495
14 TraesCS1B01G412300 chrUn 86.344 227 15 5 1657 1867 7923855 7923629 1.370000e-57 233
15 TraesCS1B01G412300 chrUn 86.344 227 15 5 1657 1867 342047791 342048017 1.370000e-57 233
16 TraesCS1B01G412300 chr5B 87.174 881 86 13 1002 1867 633761070 633761938 0.000000e+00 976
17 TraesCS1B01G412300 chr5B 94.037 436 22 4 1867 2300 685476143 685476576 0.000000e+00 658
18 TraesCS1B01G412300 chr7B 87.258 879 79 17 1002 1865 504953260 504952400 0.000000e+00 972
19 TraesCS1B01G412300 chr2B 94.226 433 21 4 1868 2300 56509163 56508735 0.000000e+00 658
20 TraesCS1B01G412300 chr2B 94.050 437 20 6 1867 2300 477872603 477873036 0.000000e+00 658
21 TraesCS1B01G412300 chr6B 93.793 435 25 2 1867 2300 417090621 417091054 0.000000e+00 652
22 TraesCS1B01G412300 chr1D 88.525 488 42 3 1394 1867 67978167 67977680 1.530000e-161 579


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G412300 chr1B 638088828 638091127 2299 True 4248.000000 4248 100.000000 1 2300 1 chr1B.!!$R2 2299
1 TraesCS1B01G412300 chr1B 638338316 638339955 1639 True 2551.000000 2551 94.817000 1 1632 1 chr1B.!!$R4 1631
2 TraesCS1B01G412300 chr1B 638249430 638251069 1639 True 2484.000000 2484 94.085000 1 1632 1 chr1B.!!$R3 1631
3 TraesCS1B01G412300 chr1B 638111966 638117714 5748 True 2379.666667 3685 97.466333 1 2300 3 chr1B.!!$R5 2299
4 TraesCS1B01G412300 chr1B 638155764 638157613 1849 True 1370.000000 2507 90.336500 1 1867 2 chr1B.!!$R6 1866
5 TraesCS1B01G412300 chr1B 549451049 549451875 826 True 994.000000 994 88.416000 1029 1866 1 chr1B.!!$R1 837
6 TraesCS1B01G412300 chrUn 7836060 7838351 2291 True 3858.000000 3858 97.001000 1 2300 1 chrUn.!!$R1 2299
7 TraesCS1B01G412300 chrUn 340564562 340566715 2153 True 3701.000000 3701 97.680000 1 2154 1 chrUn.!!$R3 2153
8 TraesCS1B01G412300 chrUn 7871078 7872929 1851 True 2630.000000 2630 92.283000 1 1867 1 chrUn.!!$R2 1866
9 TraesCS1B01G412300 chrUn 7923629 7925478 1849 True 1364.000000 2495 90.275500 1 1867 2 chrUn.!!$R4 1866
10 TraesCS1B01G412300 chr5B 633761070 633761938 868 False 976.000000 976 87.174000 1002 1867 1 chr5B.!!$F1 865
11 TraesCS1B01G412300 chr7B 504952400 504953260 860 True 972.000000 972 87.258000 1002 1865 1 chr7B.!!$R1 863

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
491 492 0.930742 CTCTATGACTCGCCGCGAAC 60.931 60.0 17.53 13.83 34.74 3.95 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2110 5745 0.034186 TGGCCTTCATCTTTGGCGAT 60.034 50.0 3.32 0.0 46.97 4.58 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
172 173 1.134367 GTCTGTCATAGTGGCGTGCTA 59.866 52.381 0.00 0.00 0.00 3.49
491 492 0.930742 CTCTATGACTCGCCGCGAAC 60.931 60.000 17.53 13.83 34.74 3.95
596 601 3.009805 AGGTTCATAACGGGTAAGCCTTT 59.990 43.478 0.00 0.00 34.45 3.11
797 804 6.157820 TGACACTATCAATTACTTGGGATCCA 59.842 38.462 15.23 0.00 33.02 3.41
838 845 5.363562 AGACATTGTAGATGAGGATGCAA 57.636 39.130 0.00 0.00 0.00 4.08
1152 1160 1.524393 GAAACCGGTGGTCGTTGGT 60.524 57.895 8.52 0.00 33.12 3.67
1479 5099 3.078196 TCATGGCGCCGTTCCCTA 61.078 61.111 21.21 0.00 0.00 3.53
1689 5310 1.234821 GAGGTTGATGTTTGGCGTCA 58.765 50.000 0.00 0.00 41.04 4.35
2132 5767 0.323725 GCCAAAGATGAAGGCCAGGA 60.324 55.000 5.01 0.00 42.58 3.86
2159 5794 3.314331 CCTGCTCACGAGGGTGGT 61.314 66.667 0.00 0.00 44.50 4.16
2238 5873 1.341531 CGACGCCCATCTTCTCCTATT 59.658 52.381 0.00 0.00 0.00 1.73
2283 5918 2.817844 ACATTAAGCAACCTTTCGGGAC 59.182 45.455 0.00 0.00 38.76 4.46
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
239 240 0.537143 GCACCACACCCTCAATGTCA 60.537 55.000 0.00 0.00 0.00 3.58
700 705 9.373750 CAAGTTACGATTGCATGTTATGATTAG 57.626 33.333 0.00 0.00 0.00 1.73
797 804 6.665992 TGTCTTATCCTAGTGTTGTGTTCT 57.334 37.500 0.00 0.00 0.00 3.01
895 903 7.654923 GGGATTCCATGCATCTTCTTTATTTTC 59.345 37.037 4.80 0.00 0.00 2.29
1245 1257 1.700186 GAACAGGGACCAAGAGGAAGT 59.300 52.381 0.00 0.00 38.69 3.01
1479 5099 4.008933 AGAGCGGCGCCTTCAAGT 62.009 61.111 30.40 7.98 0.00 3.16
1760 5395 1.204941 GGTCTGACGCACTCATAGGTT 59.795 52.381 1.07 0.00 0.00 3.50
1763 5398 0.248661 CCGGTCTGACGCACTCATAG 60.249 60.000 1.07 0.00 0.00 2.23
1765 5400 1.816863 AACCGGTCTGACGCACTCAT 61.817 55.000 8.04 0.00 0.00 2.90
1812 5447 0.532862 CTAAAGCCGGATGCCACGAT 60.533 55.000 5.05 0.00 42.71 3.73
1999 5634 2.117156 CCCAGAATTCCAGCTGCCG 61.117 63.158 8.66 0.00 0.00 5.69
2110 5745 0.034186 TGGCCTTCATCTTTGGCGAT 60.034 50.000 3.32 0.00 46.97 4.58


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.