Multiple sequence alignment - TraesCS1B01G411300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G411300 chr1B 100.000 2663 0 0 1 2663 637616827 637614165 0 4918
1 TraesCS1B01G411300 chr6A 98.725 2666 31 3 1 2663 12690991 12693656 0 4732
2 TraesCS1B01G411300 chr6A 98.688 2667 31 4 1 2663 591843361 591840695 0 4728
3 TraesCS1B01G411300 chr6A 98.125 2667 44 5 1 2663 87943546 87940882 0 4643
4 TraesCS1B01G411300 chr7A 98.650 2666 33 3 1 2663 624756691 624759356 0 4721
5 TraesCS1B01G411300 chr7A 98.090 2670 41 9 1 2663 634132808 634130142 0 4639
6 TraesCS1B01G411300 chr6B 98.426 2668 35 7 1 2663 21362096 21364761 0 4687
7 TraesCS1B01G411300 chr2B 98.275 2667 41 5 1 2663 608457623 608460288 0 4665
8 TraesCS1B01G411300 chr2A 98.165 2670 41 8 1 2663 389206953 389209621 0 4652
9 TraesCS1B01G411300 chr7B 98.088 2668 45 5 1 2663 194130142 194127476 0 4639


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G411300 chr1B 637614165 637616827 2662 True 4918 4918 100.000 1 2663 1 chr1B.!!$R1 2662
1 TraesCS1B01G411300 chr6A 12690991 12693656 2665 False 4732 4732 98.725 1 2663 1 chr6A.!!$F1 2662
2 TraesCS1B01G411300 chr6A 591840695 591843361 2666 True 4728 4728 98.688 1 2663 1 chr6A.!!$R2 2662
3 TraesCS1B01G411300 chr6A 87940882 87943546 2664 True 4643 4643 98.125 1 2663 1 chr6A.!!$R1 2662
4 TraesCS1B01G411300 chr7A 624756691 624759356 2665 False 4721 4721 98.650 1 2663 1 chr7A.!!$F1 2662
5 TraesCS1B01G411300 chr7A 634130142 634132808 2666 True 4639 4639 98.090 1 2663 1 chr7A.!!$R1 2662
6 TraesCS1B01G411300 chr6B 21362096 21364761 2665 False 4687 4687 98.426 1 2663 1 chr6B.!!$F1 2662
7 TraesCS1B01G411300 chr2B 608457623 608460288 2665 False 4665 4665 98.275 1 2663 1 chr2B.!!$F1 2662
8 TraesCS1B01G411300 chr2A 389206953 389209621 2668 False 4652 4652 98.165 1 2663 1 chr2A.!!$F1 2662
9 TraesCS1B01G411300 chr7B 194127476 194130142 2666 True 4639 4639 98.088 1 2663 1 chr7B.!!$R1 2662

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
621 623 1.064463 CACCATGGTAGCCACTTGGAT 60.064 52.381 19.28 0.00 35.80 3.41 F
648 650 2.149803 TACTGCCTAGTTGCGCACGT 62.150 55.000 11.12 1.83 38.36 4.49 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1551 1559 1.986698 CCGATTTGTACCGTCGACTT 58.013 50.000 14.7 2.72 37.55 3.01 R
2021 2034 3.258372 AGTTGCTGAGATACGACAAGGAA 59.742 43.478 0.0 0.00 0.00 3.36 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
72 73 2.060326 TCTCGAAACTACTTGGTGCG 57.940 50.000 0.00 0.00 0.00 5.34
167 168 2.626785 TCCTCAAGGTGTTCACCCATA 58.373 47.619 17.06 3.55 36.34 2.74
193 194 2.670905 CGTTGATGTCATACCGCAAAGA 59.329 45.455 0.00 0.00 0.00 2.52
436 438 6.871492 TGAACAAGTCCAAGAAAAGGAAAAAC 59.129 34.615 0.00 0.00 36.80 2.43
495 497 3.961840 AGGACCTCCTCCACCTCT 58.038 61.111 0.00 0.00 44.77 3.69
621 623 1.064463 CACCATGGTAGCCACTTGGAT 60.064 52.381 19.28 0.00 35.80 3.41
648 650 2.149803 TACTGCCTAGTTGCGCACGT 62.150 55.000 11.12 1.83 38.36 4.49
2063 2076 2.675242 CCTCCATGGGGCGGTGTTA 61.675 63.158 13.02 0.00 34.13 2.41
2615 2631 2.070039 CCCCCGCAATGGTAGAGGA 61.070 63.158 0.00 0.00 35.15 3.71
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
72 73 4.432741 GCTCCTCCACCCTTGCCC 62.433 72.222 0.00 0.00 0.00 5.36
167 168 1.939934 CGGTATGACATCAACGCCAAT 59.060 47.619 0.00 0.00 0.00 3.16
193 194 1.755380 GTCCACCGTCTTAGCAGGTAT 59.245 52.381 0.00 0.00 36.34 2.73
495 497 3.334604 CCCCCTGATTGCTGCCTA 58.665 61.111 0.00 0.00 0.00 3.93
621 623 4.430007 CGCAACTAGGCAGTATGTTCTTA 58.570 43.478 0.00 0.00 39.31 2.10
648 650 4.572795 TCTTTGATGCGTGAACTAACACAA 59.427 37.500 0.00 0.00 40.34 3.33
1551 1559 1.986698 CCGATTTGTACCGTCGACTT 58.013 50.000 14.70 2.72 37.55 3.01
1648 1656 4.953940 AACAGAATCATAGGAGCCTCTC 57.046 45.455 0.00 0.00 0.00 3.20
2021 2034 3.258372 AGTTGCTGAGATACGACAAGGAA 59.742 43.478 0.00 0.00 0.00 3.36
2063 2076 3.952508 TGGGTCACCAGCGTGCAT 61.953 61.111 0.00 0.00 43.37 3.96
2385 2401 9.682465 ACACAGTACTAGTCTTCAATCTGTATA 57.318 33.333 0.00 0.00 34.29 1.47
2493 2509 5.393461 GCAGCTTGGCAAGTAAGACAATAAT 60.393 40.000 26.71 0.00 35.62 1.28
2615 2631 4.581824 ACAACATTGAGCTGATGAACAACT 59.418 37.500 12.36 0.00 0.00 3.16


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.