Multiple sequence alignment - TraesCS1B01G406800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G406800 chr1B 100.000 2211 0 0 1 2211 633749012 633751222 0 4084
1 TraesCS1B01G406800 chr3B 99.145 1404 12 0 1 1404 101916062 101914659 0 2527
2 TraesCS1B01G406800 chr3A 98.932 1404 15 0 1 1404 66012739 66014142 0 2510
3 TraesCS1B01G406800 chr3A 98.860 1404 16 0 1 1404 164859179 164860582 0 2505
4 TraesCS1B01G406800 chr3A 98.274 811 13 1 1402 2211 593309493 593310303 0 1419
5 TraesCS1B01G406800 chr3A 97.904 811 16 1 1402 2211 105553988 105553178 0 1402
6 TraesCS1B01G406800 chr6D 98.860 1404 16 0 1 1404 168262552 168261149 0 2505
7 TraesCS1B01G406800 chr5A 98.860 1404 16 0 1 1404 510135610 510137013 0 2505
8 TraesCS1B01G406800 chr5A 98.397 811 12 1 1402 2211 559028978 559028168 0 1424
9 TraesCS1B01G406800 chr5D 98.718 1404 18 0 1 1404 503223102 503221699 0 2494
10 TraesCS1B01G406800 chrUn 98.647 1404 17 1 1 1404 216513723 216515124 0 2486
11 TraesCS1B01G406800 chrUn 98.647 1404 17 1 1 1404 286269660 286268259 0 2486
12 TraesCS1B01G406800 chrUn 97.781 811 17 1 1402 2211 345936259 345935449 0 1397
13 TraesCS1B01G406800 chr3D 98.504 1404 20 1 1 1404 589272074 589273476 0 2475
14 TraesCS1B01G406800 chr2B 98.520 811 11 1 1402 2211 683730413 683731223 0 1430
15 TraesCS1B01G406800 chr1A 98.276 812 12 2 1402 2211 554484993 554485804 0 1421
16 TraesCS1B01G406800 chr5B 97.904 811 16 1 1402 2211 57511073 57510263 0 1402
17 TraesCS1B01G406800 chr7B 97.781 811 17 1 1402 2211 662752098 662751288 0 1397
18 TraesCS1B01G406800 chr6B 97.781 811 16 2 1402 2211 450074136 450074945 0 1397


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G406800 chr1B 633749012 633751222 2210 False 4084 4084 100.000 1 2211 1 chr1B.!!$F1 2210
1 TraesCS1B01G406800 chr3B 101914659 101916062 1403 True 2527 2527 99.145 1 1404 1 chr3B.!!$R1 1403
2 TraesCS1B01G406800 chr3A 66012739 66014142 1403 False 2510 2510 98.932 1 1404 1 chr3A.!!$F1 1403
3 TraesCS1B01G406800 chr3A 164859179 164860582 1403 False 2505 2505 98.860 1 1404 1 chr3A.!!$F2 1403
4 TraesCS1B01G406800 chr3A 593309493 593310303 810 False 1419 1419 98.274 1402 2211 1 chr3A.!!$F3 809
5 TraesCS1B01G406800 chr3A 105553178 105553988 810 True 1402 1402 97.904 1402 2211 1 chr3A.!!$R1 809
6 TraesCS1B01G406800 chr6D 168261149 168262552 1403 True 2505 2505 98.860 1 1404 1 chr6D.!!$R1 1403
7 TraesCS1B01G406800 chr5A 510135610 510137013 1403 False 2505 2505 98.860 1 1404 1 chr5A.!!$F1 1403
8 TraesCS1B01G406800 chr5A 559028168 559028978 810 True 1424 1424 98.397 1402 2211 1 chr5A.!!$R1 809
9 TraesCS1B01G406800 chr5D 503221699 503223102 1403 True 2494 2494 98.718 1 1404 1 chr5D.!!$R1 1403
10 TraesCS1B01G406800 chrUn 216513723 216515124 1401 False 2486 2486 98.647 1 1404 1 chrUn.!!$F1 1403
11 TraesCS1B01G406800 chrUn 286268259 286269660 1401 True 2486 2486 98.647 1 1404 1 chrUn.!!$R1 1403
12 TraesCS1B01G406800 chrUn 345935449 345936259 810 True 1397 1397 97.781 1402 2211 1 chrUn.!!$R2 809
13 TraesCS1B01G406800 chr3D 589272074 589273476 1402 False 2475 2475 98.504 1 1404 1 chr3D.!!$F1 1403
14 TraesCS1B01G406800 chr2B 683730413 683731223 810 False 1430 1430 98.520 1402 2211 1 chr2B.!!$F1 809
15 TraesCS1B01G406800 chr1A 554484993 554485804 811 False 1421 1421 98.276 1402 2211 1 chr1A.!!$F1 809
16 TraesCS1B01G406800 chr5B 57510263 57511073 810 True 1402 1402 97.904 1402 2211 1 chr5B.!!$R1 809
17 TraesCS1B01G406800 chr7B 662751288 662752098 810 True 1397 1397 97.781 1402 2211 1 chr7B.!!$R1 809
18 TraesCS1B01G406800 chr6B 450074136 450074945 809 False 1397 1397 97.781 1402 2211 1 chr6B.!!$F1 809

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
276 277 2.779755 TGGTCTACGTACCGGAACTA 57.22 50.0 9.46 0.0 42.91 2.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2117 2119 0.906775 GTTCCATTCCCACTACCGGA 59.093 55.0 9.46 0.0 0.0 5.14 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
127 128 3.120889 CGTATGCTTGCATATTCGTCCAG 60.121 47.826 16.86 1.21 0.00 3.86
276 277 2.779755 TGGTCTACGTACCGGAACTA 57.220 50.000 9.46 0.00 42.91 2.24
457 458 7.510675 TCTTGGTTTCAATAGGACTCCTTAT 57.489 36.000 1.94 0.00 34.61 1.73
702 703 8.251721 TGCTAGGTCTATTTCTTAGTTCAAGAC 58.748 37.037 0.00 0.00 43.09 3.01
916 917 8.375493 ACTCTGTTTACATAGAAATCCCTACA 57.625 34.615 2.71 0.00 0.00 2.74
1289 1290 2.288213 ACACGCGAGACTCAAAATCTCA 60.288 45.455 15.93 0.00 42.39 3.27
1363 1364 3.385314 TCATTCAATGAGCATTCCCCA 57.615 42.857 0.00 0.00 33.59 4.96
1404 1405 3.124686 CCTGGCGCTCTCCTCTAC 58.875 66.667 7.64 0.00 0.00 2.59
1405 1406 1.454847 CCTGGCGCTCTCCTCTACT 60.455 63.158 7.64 0.00 0.00 2.57
1451 1452 0.610174 ACAATTCGCCTCTGCTCTCA 59.390 50.000 0.00 0.00 34.43 3.27
1939 1940 9.198475 CTATACCAAAGGTTTAGAAGACCTCTA 57.802 37.037 7.61 0.00 46.60 2.43
2132 2134 1.128200 TGGATCCGGTAGTGGGAATG 58.872 55.000 7.39 0.00 37.07 2.67
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
127 128 7.865706 ATAATTACATATCCGATTTGCCCTC 57.134 36.000 0.00 0.00 0.00 4.30
160 161 9.205719 CATATCCATCATTTGAGTCTCTAACAG 57.794 37.037 0.65 0.00 0.00 3.16
165 166 6.183810 TGCATATCCATCATTTGAGTCTCT 57.816 37.500 0.65 0.00 0.00 3.10
207 208 9.828691 TCCTAGATTCATGGAGATATAGAACAA 57.171 33.333 0.00 0.00 0.00 2.83
276 277 8.627208 AATCCTGCATAATCTCGAATGTTATT 57.373 30.769 0.00 0.00 0.00 1.40
702 703 7.858498 TCTTTTATTCCAGTTAGTAAGAGGGG 58.142 38.462 1.75 0.00 0.00 4.79
1363 1364 5.513267 GCCCAGATTTCCGGAATACTTCTAT 60.513 44.000 19.62 6.33 0.00 1.98
1404 1405 3.181516 GGCTTGTAACTCTGCGAATTGAG 60.182 47.826 0.00 0.00 36.47 3.02
1405 1406 2.742053 GGCTTGTAACTCTGCGAATTGA 59.258 45.455 0.00 0.00 0.00 2.57
1451 1452 8.149647 TGCCAATTGATTCTGACTTGTTTTATT 58.850 29.630 7.12 0.00 0.00 1.40
2117 2119 0.906775 GTTCCATTCCCACTACCGGA 59.093 55.000 9.46 0.00 0.00 5.14
2132 2134 2.989253 CTTGGGGTTGCGGGTTCC 60.989 66.667 0.00 0.00 0.00 3.62


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.