Multiple sequence alignment - TraesCS1B01G406600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G406600 chr1B 100.000 2470 0 0 1 2470 633745674 633748143 0 4562
1 TraesCS1B01G406600 chr5D 98.545 2474 32 4 1 2470 503226443 503223970 0 4366
2 TraesCS1B01G406600 chr5D 98.263 2475 38 5 1 2470 503270101 503272575 0 4327
3 TraesCS1B01G406600 chr5D 97.901 2477 44 6 1 2470 503236760 503234285 0 4279
4 TraesCS1B01G406600 chr3A 98.343 2474 36 5 1 2470 66009398 66011870 0 4337
5 TraesCS1B01G406600 chr3A 97.253 2475 62 6 1 2470 672901788 672904261 0 4189
6 TraesCS1B01G406600 chrUn 97.897 2473 48 4 1 2470 216510383 216512854 0 4276
7 TraesCS1B01G406600 chrUn 97.897 2473 48 4 1 2470 286273000 286270529 0 4276
8 TraesCS1B01G406600 chr3B 97.859 2476 47 4 1 2470 201535254 201532779 0 4274
9 TraesCS1B01G406600 chr2B 97.736 2473 49 7 1 2470 474916663 474914195 0 4250


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G406600 chr1B 633745674 633748143 2469 False 4562 4562 100.000 1 2470 1 chr1B.!!$F1 2469
1 TraesCS1B01G406600 chr5D 503223970 503226443 2473 True 4366 4366 98.545 1 2470 1 chr5D.!!$R1 2469
2 TraesCS1B01G406600 chr5D 503270101 503272575 2474 False 4327 4327 98.263 1 2470 1 chr5D.!!$F1 2469
3 TraesCS1B01G406600 chr5D 503234285 503236760 2475 True 4279 4279 97.901 1 2470 1 chr5D.!!$R2 2469
4 TraesCS1B01G406600 chr3A 66009398 66011870 2472 False 4337 4337 98.343 1 2470 1 chr3A.!!$F1 2469
5 TraesCS1B01G406600 chr3A 672901788 672904261 2473 False 4189 4189 97.253 1 2470 1 chr3A.!!$F2 2469
6 TraesCS1B01G406600 chrUn 216510383 216512854 2471 False 4276 4276 97.897 1 2470 1 chrUn.!!$F1 2469
7 TraesCS1B01G406600 chrUn 286270529 286273000 2471 True 4276 4276 97.897 1 2470 1 chrUn.!!$R1 2469
8 TraesCS1B01G406600 chr3B 201532779 201535254 2475 True 4274 4274 97.859 1 2470 1 chr3B.!!$R1 2469
9 TraesCS1B01G406600 chr2B 474914195 474916663 2468 True 4250 4250 97.736 1 2470 1 chr2B.!!$R1 2469

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
379 381 0.788391 CGTCAACAAGGGCGTTCTAC 59.212 55.0 0.0 0.0 0.00 2.59 F
1010 1015 0.031449 TTCACGCTCATGTCACGTCA 59.969 50.0 7.3 0.0 38.09 4.35 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1434 1440 3.204526 CAAGAGCTCTATTTGCCTCTGG 58.795 50.000 18.59 0.0 0.0 3.86 R
2172 2178 4.554553 AACATTCCCCCTAGAGTAGCTA 57.445 45.455 0.00 0.0 0.0 3.32 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
139 140 5.084519 ACAGTAAGGGTGACTTATCTGTCA 58.915 41.667 12.34 0.00 43.03 3.58
343 345 5.279506 GCATTATTCGAGGAACCCTAGATGA 60.280 44.000 0.00 0.00 35.34 2.92
349 351 2.959707 GAGGAACCCTAGATGATGTCGT 59.040 50.000 0.00 0.00 31.76 4.34
379 381 0.788391 CGTCAACAAGGGCGTTCTAC 59.212 55.000 0.00 0.00 0.00 2.59
450 452 5.107104 TGTGAATCGCTAGAAACATGTGAAC 60.107 40.000 0.00 0.00 0.00 3.18
478 480 4.456566 TGGCTAACCCAATAACGAAAGTTC 59.543 41.667 0.00 0.00 46.82 3.01
642 645 6.847956 TTCGAAATACCTCGACTTTTTCAA 57.152 33.333 0.00 0.00 46.95 2.69
758 761 6.749036 AAATACAGGATTTCCGATCCTAGT 57.251 37.500 7.22 10.06 46.22 2.57
1010 1015 0.031449 TTCACGCTCATGTCACGTCA 59.969 50.000 7.30 0.00 38.09 4.35
1237 1242 7.388712 CAATATAGGAGTAAAAACACGACGTG 58.611 38.462 25.72 25.72 39.75 4.49
1264 1269 0.037605 AGGATCGACGCGGAAAGTTT 60.038 50.000 12.47 0.00 0.00 2.66
1405 1411 2.399607 AAAGGGAGTGGGGTGCCAA 61.400 57.895 0.00 0.00 0.00 4.52
1434 1440 3.104843 AGGAAGCGACTCATAGAATGC 57.895 47.619 0.00 0.00 0.00 3.56
1551 1557 6.325028 AGAATCAATAGAAGGAGAATCGGACA 59.675 38.462 0.00 0.00 34.37 4.02
1595 1601 8.239681 ACAAAAAGGAAAAGAAAGAGAAAACG 57.760 30.769 0.00 0.00 0.00 3.60
1756 1762 3.610911 GGACTTTTCGGAGATTGGATGT 58.389 45.455 0.00 0.00 35.04 3.06
1849 1855 4.574599 AGCGTTTCATTTGCTTCTCTTT 57.425 36.364 0.00 0.00 34.80 2.52
1884 1890 9.540538 TTTCATTTTCCCAGAATGTATCCTAAA 57.459 29.630 0.00 0.00 36.23 1.85
1912 1918 6.060136 TGGCCTAATTCTTCTTCTGATGATG 58.940 40.000 3.32 0.00 0.00 3.07
1923 1929 6.813293 TCTTCTGATGATGGATTCAACCTA 57.187 37.500 0.00 0.00 38.03 3.08
2210 2216 6.451393 GGAATGTTTTTATGTGGTGCTAACA 58.549 36.000 0.00 0.00 0.00 2.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
139 140 4.463050 TGGGGTTGATAGTGGAAAAGTT 57.537 40.909 0.00 0.00 0.00 2.66
173 174 2.550606 CTGGCAACTTTACGTAAGGCAA 59.449 45.455 16.53 8.38 38.23 4.52
343 345 6.384224 TGTTGACGATTCTTTACTACGACAT 58.616 36.000 0.00 0.00 0.00 3.06
349 351 4.933400 GCCCTTGTTGACGATTCTTTACTA 59.067 41.667 0.00 0.00 0.00 1.82
379 381 6.019479 GTCTTGGATAAGAATCTACAACGCAG 60.019 42.308 0.00 0.00 44.12 5.18
450 452 4.699637 TCGTTATTGGGTTAGCCATACAG 58.300 43.478 3.24 0.00 36.17 2.74
478 480 1.961180 CTGCTCCAGTCCCCTTACGG 61.961 65.000 0.00 0.00 0.00 4.02
642 645 3.244422 TGCTATTTGACTCGGACCTGTTT 60.244 43.478 0.00 0.00 0.00 2.83
758 761 0.111639 CCGTTTCCCTCCTTTTCCCA 59.888 55.000 0.00 0.00 0.00 4.37
1264 1269 8.482943 TCCTTGTTTAGATCCTATTTCAATCGA 58.517 33.333 0.00 0.00 0.00 3.59
1434 1440 3.204526 CAAGAGCTCTATTTGCCTCTGG 58.795 50.000 18.59 0.00 0.00 3.86
1595 1601 5.136105 AGGGCTTAGTTGATCATGATTTCC 58.864 41.667 10.14 0.00 0.00 3.13
1756 1762 8.432013 ACATGCCAGATCATGAATTAGTAACTA 58.568 33.333 0.00 0.00 44.94 2.24
1849 1855 7.847711 TTCTGGGAAAATGAAACTTCCATTA 57.152 32.000 3.44 0.00 42.56 1.90
1884 1890 7.616935 TCATCAGAAGAAGAATTAGGCCAAAAT 59.383 33.333 5.01 0.62 0.00 1.82
1923 1929 8.112183 AGAACCAAGGTCTATCTTTTTGATCAT 58.888 33.333 0.00 0.00 36.65 2.45
2172 2178 4.554553 AACATTCCCCCTAGAGTAGCTA 57.445 45.455 0.00 0.00 0.00 3.32


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.