Multiple sequence alignment - TraesCS1B01G406500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G406500 chr1B 100.000 2177 0 0 1 2177 633743659 633745835 0 4021
1 TraesCS1B01G406500 chr6D 98.213 2183 33 1 1 2177 389254923 389252741 0 3810
2 TraesCS1B01G406500 chr5D 98.122 2183 34 2 1 2177 503238780 503236599 0 3797
3 TraesCS1B01G406500 chr5D 98.159 2173 33 2 11 2177 503243019 503240848 0 3784
4 TraesCS1B01G406500 chr3A 98.122 2183 34 2 1 2177 66007378 66009559 0 3797
5 TraesCS1B01G406500 chr3A 97.618 2183 46 1 1 2177 672899767 672901949 0 3738
6 TraesCS1B01G406500 chrUn 97.800 2182 42 4 1 2177 216508364 216510544 0 3759
7 TraesCS1B01G406500 chr3B 97.618 2183 45 2 1 2177 201537274 201535093 0 3736
8 TraesCS1B01G406500 chr2A 97.251 2183 54 1 1 2177 335845066 335842884 0 3694
9 TraesCS1B01G406500 chr2B 97.206 2183 55 1 1 2177 474918684 474916502 0 3688


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G406500 chr1B 633743659 633745835 2176 False 4021.0 4021 100.0000 1 2177 1 chr1B.!!$F1 2176
1 TraesCS1B01G406500 chr6D 389252741 389254923 2182 True 3810.0 3810 98.2130 1 2177 1 chr6D.!!$R1 2176
2 TraesCS1B01G406500 chr5D 503236599 503243019 6420 True 3790.5 3797 98.1405 1 2177 2 chr5D.!!$R1 2176
3 TraesCS1B01G406500 chr3A 66007378 66009559 2181 False 3797.0 3797 98.1220 1 2177 1 chr3A.!!$F1 2176
4 TraesCS1B01G406500 chr3A 672899767 672901949 2182 False 3738.0 3738 97.6180 1 2177 1 chr3A.!!$F2 2176
5 TraesCS1B01G406500 chrUn 216508364 216510544 2180 False 3759.0 3759 97.8000 1 2177 1 chrUn.!!$F1 2176
6 TraesCS1B01G406500 chr3B 201535093 201537274 2181 True 3736.0 3736 97.6180 1 2177 1 chr3B.!!$R1 2176
7 TraesCS1B01G406500 chr2A 335842884 335845066 2182 True 3694.0 3694 97.2510 1 2177 1 chr2A.!!$R1 2176
8 TraesCS1B01G406500 chr2B 474916502 474918684 2182 True 3688.0 3688 97.2060 1 2177 1 chr2B.!!$R1 2176

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
61 62 0.390735 GTTACTCACCCGTTCGCCAT 60.391 55.000 0.0 0.0 0.0 4.40 F
536 537 1.003696 CTTCCTCCGGGCTTTCTTTCT 59.996 52.381 0.0 0.0 0.0 2.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1140 5390 2.133281 TGGAACATGGATTCTGGCAG 57.867 50.000 8.58 8.58 0.0 4.85 R
1442 5692 2.628178 TCCGATCGATTGCATAAGACCT 59.372 45.455 18.66 0.00 0.0 3.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
61 62 0.390735 GTTACTCACCCGTTCGCCAT 60.391 55.000 0.00 0.0 0.00 4.40
64 65 1.375396 CTCACCCGTTCGCCATTGA 60.375 57.895 0.00 0.0 0.00 2.57
103 104 4.249661 TCGACTTGCATGTGTTAAGCATA 58.750 39.130 10.37 0.0 38.19 3.14
196 197 7.778083 TCCTTATTCGTAGACAAAGCAGATTA 58.222 34.615 0.00 0.0 34.32 1.75
197 198 8.255206 TCCTTATTCGTAGACAAAGCAGATTAA 58.745 33.333 0.00 0.0 34.32 1.40
328 329 3.314693 AGCCTCTTATCCATTCCCGTTA 58.685 45.455 0.00 0.0 0.00 3.18
457 458 3.116862 TGAGTTATATCCCTTCCCCGTCT 60.117 47.826 0.00 0.0 0.00 4.18
536 537 1.003696 CTTCCTCCGGGCTTTCTTTCT 59.996 52.381 0.00 0.0 0.00 2.52
671 672 5.828747 TCTGTACGATTTTCCCGATCTAAG 58.171 41.667 0.00 0.0 0.00 2.18
1140 5390 0.251341 AGGACCCAACTCCATTGCAC 60.251 55.000 0.00 0.0 36.93 4.57
1239 5489 0.466124 CCCTTTCTCCTCGGTCCATC 59.534 60.000 0.00 0.0 0.00 3.51
1277 5527 0.324614 TGGTGCCGACAGTTCATCAT 59.675 50.000 0.00 0.0 0.00 2.45
1299 5549 3.389329 TGGAAGAAAGAACTCACAGAGCT 59.611 43.478 0.00 0.0 32.04 4.09
1442 5692 1.202371 CCTCGTTCTATTGCTACCGCA 60.202 52.381 0.00 0.0 46.24 5.69
1806 6057 2.952978 TCGAAGATAGAAGAGCCCAGAC 59.047 50.000 0.00 0.0 0.00 3.51
2154 6411 5.084519 ACAGTAAGGGTGACTTATCTGTCA 58.915 41.667 12.34 0.0 43.03 3.58
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
61 62 2.131776 ACGGGAAGTGGTGTTTTCAA 57.868 45.000 0.00 0.00 0.00 2.69
64 65 1.018910 CGAACGGGAAGTGGTGTTTT 58.981 50.000 0.00 0.00 0.00 2.43
103 104 3.706373 AGGATGAACGCTGGCGGT 61.706 61.111 18.99 13.01 44.58 5.68
457 458 7.435488 GGATTCGTTAATTCTCTTTCTCGATGA 59.565 37.037 0.00 0.00 0.00 2.92
671 672 1.734465 CTTCATGGAAACCTGCTCGAC 59.266 52.381 0.00 0.00 0.00 4.20
1140 5390 2.133281 TGGAACATGGATTCTGGCAG 57.867 50.000 8.58 8.58 0.00 4.85
1277 5527 3.389329 AGCTCTGTGAGTTCTTTCTTCCA 59.611 43.478 0.00 0.00 31.39 3.53
1299 5549 7.749666 AGTAGTACTATTAGTTACCGATCCCA 58.250 38.462 5.75 0.00 0.00 4.37
1442 5692 2.628178 TCCGATCGATTGCATAAGACCT 59.372 45.455 18.66 0.00 0.00 3.85
1668 5918 8.380742 AGAGAACCTTTTCCTCTGTATGAATA 57.619 34.615 0.00 0.00 31.28 1.75
1778 6029 6.153756 GGGCTCTTCTATCTTCGACTTATTC 58.846 44.000 0.00 0.00 0.00 1.75
1806 6057 6.072508 TCGAGTTTCCATTTCTTCATTTGGAG 60.073 38.462 0.00 0.00 39.33 3.86
1920 6177 8.712228 AGGAGAAGATTGTTCTTTTACCAAAT 57.288 30.769 0.00 0.00 42.34 2.32
2154 6411 4.463050 TGGGGTTGATAGTGGAAAAGTT 57.537 40.909 0.00 0.00 0.00 2.66


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.