Multiple sequence alignment - TraesCS1B01G406200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G406200 chr1B 100.000 1459 0 0 914 2372 633738340 633736882 0.000000e+00 2695
1 TraesCS1B01G406200 chr1B 100.000 239 0 0 1 239 633739253 633739015 2.160000e-120 442
2 TraesCS1B01G406200 chr1B 100.000 239 0 0 1 239 638729013 638729251 2.160000e-120 442
3 TraesCS1B01G406200 chr3A 97.360 1477 17 1 918 2372 66004019 66002543 0.000000e+00 2492
4 TraesCS1B01G406200 chr3A 100.000 239 0 0 1 239 66004758 66004520 2.160000e-120 442
5 TraesCS1B01G406200 chr3A 100.000 239 0 0 1 239 122226788 122227026 2.160000e-120 442
6 TraesCS1B01G406200 chr5D 97.224 1477 19 1 918 2372 503263662 503262186 0.000000e+00 2481
7 TraesCS1B01G406200 chr5D 97.089 1477 21 1 918 2372 503246386 503247862 0.000000e+00 2470
8 TraesCS1B01G406200 chr2D 97.224 1477 19 1 918 2372 272811132 272809656 0.000000e+00 2481
9 TraesCS1B01G406200 chr2D 96.886 1477 24 1 918 2372 591985723 591987199 0.000000e+00 2453
10 TraesCS1B01G406200 chr2A 97.224 1477 19 1 918 2372 726905341 726903865 0.000000e+00 2481
11 TraesCS1B01G406200 chr3D 97.156 1477 19 2 918 2372 589262412 589260937 0.000000e+00 2473
12 TraesCS1B01G406200 chr3D 100.000 239 0 0 1 239 589263151 589262913 2.160000e-120 442
13 TraesCS1B01G406200 chr6D 97.089 1477 21 1 918 2372 389244708 389243232 0.000000e+00 2470
14 TraesCS1B01G406200 chr6D 100.000 239 0 0 1 239 389245447 389245209 2.160000e-120 442
15 TraesCS1B01G406200 chr1D 96.682 1477 27 1 918 2372 459903603 459902127 0.000000e+00 2436
16 TraesCS1B01G406200 chr1D 100.000 239 0 0 1 239 254381626 254381388 2.160000e-120 442
17 TraesCS1B01G406200 chr7D 97.070 1297 16 1 1098 2372 231608206 231606910 0.000000e+00 2165
18 TraesCS1B01G406200 chr7D 96.881 1058 11 1 918 1953 77247365 77248422 0.000000e+00 1751
19 TraesCS1B01G406200 chr7D 98.324 895 13 2 1478 2372 231606220 231605328 0.000000e+00 1568
20 TraesCS1B01G406200 chr7B 96.211 739 6 1 918 1634 662727518 662728256 0.000000e+00 1190
21 TraesCS1B01G406200 chr7B 100.000 239 0 0 1 239 662726779 662727017 2.160000e-120 442
22 TraesCS1B01G406200 chr5B 100.000 239 0 0 1 239 127808269 127808507 2.160000e-120 442
23 TraesCS1B01G406200 chr3B 100.000 239 0 0 1 239 201539897 201540135 2.160000e-120 442


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G406200 chr1B 633736882 633739253 2371 True 1568.5 2695 100.0000 1 2372 2 chr1B.!!$R1 2371
1 TraesCS1B01G406200 chr3A 66002543 66004758 2215 True 1467.0 2492 98.6800 1 2372 2 chr3A.!!$R1 2371
2 TraesCS1B01G406200 chr5D 503262186 503263662 1476 True 2481.0 2481 97.2240 918 2372 1 chr5D.!!$R1 1454
3 TraesCS1B01G406200 chr5D 503246386 503247862 1476 False 2470.0 2470 97.0890 918 2372 1 chr5D.!!$F1 1454
4 TraesCS1B01G406200 chr2D 272809656 272811132 1476 True 2481.0 2481 97.2240 918 2372 1 chr2D.!!$R1 1454
5 TraesCS1B01G406200 chr2D 591985723 591987199 1476 False 2453.0 2453 96.8860 918 2372 1 chr2D.!!$F1 1454
6 TraesCS1B01G406200 chr2A 726903865 726905341 1476 True 2481.0 2481 97.2240 918 2372 1 chr2A.!!$R1 1454
7 TraesCS1B01G406200 chr3D 589260937 589263151 2214 True 1457.5 2473 98.5780 1 2372 2 chr3D.!!$R1 2371
8 TraesCS1B01G406200 chr6D 389243232 389245447 2215 True 1456.0 2470 98.5445 1 2372 2 chr6D.!!$R1 2371
9 TraesCS1B01G406200 chr1D 459902127 459903603 1476 True 2436.0 2436 96.6820 918 2372 1 chr1D.!!$R2 1454
10 TraesCS1B01G406200 chr7D 231605328 231608206 2878 True 1866.5 2165 97.6970 1098 2372 2 chr7D.!!$R1 1274
11 TraesCS1B01G406200 chr7D 77247365 77248422 1057 False 1751.0 1751 96.8810 918 1953 1 chr7D.!!$F1 1035
12 TraesCS1B01G406200 chr7B 662726779 662728256 1477 False 816.0 1190 98.1055 1 1634 2 chr7B.!!$F1 1633

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1038 1039 0.249657 GCTTATCTCCAGCCCGTGAG 60.25 60.0 0.0 0.0 0.0 3.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2064 3671 0.179145 CTCGATTTGGTACCGCTCGT 60.179 55.0 22.24 3.33 0.0 4.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1038 1039 0.249657 GCTTATCTCCAGCCCGTGAG 60.250 60.000 0.00 0.00 0.00 3.51
1176 1177 3.881089 GGCATAGCCTTAACGTTAATGGT 59.119 43.478 24.48 24.48 46.69 3.55
1613 3219 3.135895 GCAAGGCTAAATACTCCTGGGTA 59.864 47.826 0.00 0.00 0.00 3.69
1815 3421 2.181021 CGGAGCCGTAGCGAAAGT 59.819 61.111 0.00 0.00 46.67 2.66
1850 3456 2.874701 GCGATTGTCACTGCTTATGGAT 59.125 45.455 0.00 0.00 0.00 3.41
1853 3459 3.998913 TTGTCACTGCTTATGGATCCA 57.001 42.857 18.88 18.88 0.00 3.41
1860 3466 3.010584 ACTGCTTATGGATCCAAACCTGT 59.989 43.478 20.67 13.77 0.00 4.00
1876 3482 5.698741 AACCTGTGTGATCTATCCATGAA 57.301 39.130 0.00 0.00 0.00 2.57
2006 3612 1.644786 GGTTCTCCCCGAAATGCGTG 61.645 60.000 0.00 0.00 38.67 5.34
2048 3654 3.182152 ACATCTAGGGGTAAAGCACTGT 58.818 45.455 0.00 0.00 0.00 3.55
2207 3814 0.181350 CACCAGCTAAGGCCCCTAAG 59.819 60.000 0.00 0.00 39.73 2.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1038 1039 4.035324 TCGCTATCATAGTATCCGCTAAGC 59.965 45.833 0.00 0.00 0.00 3.09
1176 1177 3.117512 AGCCTTTCCTCTTTTGAACCTCA 60.118 43.478 0.00 0.00 0.00 3.86
1613 3219 2.289002 CGGTACTACTTCGCTATCGGTT 59.711 50.000 0.00 0.00 36.13 4.44
1815 3421 4.404394 TGACAATCGCCCTATTAAGACTCA 59.596 41.667 0.00 0.00 0.00 3.41
1850 3456 3.843619 TGGATAGATCACACAGGTTTGGA 59.156 43.478 0.00 0.00 0.00 3.53
1853 3459 5.698741 TCATGGATAGATCACACAGGTTT 57.301 39.130 0.00 0.00 0.00 3.27
1860 3466 5.603813 TCATCCTGTTCATGGATAGATCACA 59.396 40.000 0.00 0.00 41.94 3.58
1876 3482 3.726557 TTCATCCAAGCTTCATCCTGT 57.273 42.857 0.00 0.00 0.00 4.00
2006 3612 3.426568 GTCAACTGCTGCGCCTCC 61.427 66.667 4.18 0.00 0.00 4.30
2064 3671 0.179145 CTCGATTTGGTACCGCTCGT 60.179 55.000 22.24 3.33 0.00 4.18
2207 3814 2.094182 TCCTTTATCACTGAGCGGTCAC 60.094 50.000 14.39 0.00 0.00 3.67


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.