Multiple sequence alignment - TraesCS1B01G406000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G406000 chr1B 100.000 2273 0 0 1 2273 633733490 633731218 0 4198
1 TraesCS1B01G406000 chr7B 98.418 2275 32 4 1 2273 662732894 662735166 0 3999
2 TraesCS1B01G406000 chr7B 98.462 1626 22 3 1 1624 622431988 622430364 0 2861
3 TraesCS1B01G406000 chr3B 98.154 2275 39 3 1 2273 201565401 201563128 0 3965
4 TraesCS1B01G406000 chr1D 97.933 2274 45 2 1 2273 254531578 254533850 0 3938
5 TraesCS1B01G406000 chr3A 97.846 2275 45 4 1 2273 672883048 672880776 0 3927
6 TraesCS1B01G406000 chr3A 97.813 2241 46 3 1 2239 695636380 695638619 0 3864
7 TraesCS1B01G406000 chr6B 97.061 2280 43 13 1 2273 615601610 615599348 0 3818
8 TraesCS1B01G406000 chr2A 98.448 2126 30 3 1 2124 543187641 543189765 0 3740
9 TraesCS1B01G406000 chr5B 95.305 2279 78 12 1 2273 432872129 432874384 0 3589
10 TraesCS1B01G406000 chr7A 94.318 1795 88 10 484 2273 352681572 352679787 0 2737


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G406000 chr1B 633731218 633733490 2272 True 4198 4198 100.000 1 2273 1 chr1B.!!$R1 2272
1 TraesCS1B01G406000 chr7B 662732894 662735166 2272 False 3999 3999 98.418 1 2273 1 chr7B.!!$F1 2272
2 TraesCS1B01G406000 chr7B 622430364 622431988 1624 True 2861 2861 98.462 1 1624 1 chr7B.!!$R1 1623
3 TraesCS1B01G406000 chr3B 201563128 201565401 2273 True 3965 3965 98.154 1 2273 1 chr3B.!!$R1 2272
4 TraesCS1B01G406000 chr1D 254531578 254533850 2272 False 3938 3938 97.933 1 2273 1 chr1D.!!$F1 2272
5 TraesCS1B01G406000 chr3A 672880776 672883048 2272 True 3927 3927 97.846 1 2273 1 chr3A.!!$R1 2272
6 TraesCS1B01G406000 chr3A 695636380 695638619 2239 False 3864 3864 97.813 1 2239 1 chr3A.!!$F1 2238
7 TraesCS1B01G406000 chr6B 615599348 615601610 2262 True 3818 3818 97.061 1 2273 1 chr6B.!!$R1 2272
8 TraesCS1B01G406000 chr2A 543187641 543189765 2124 False 3740 3740 98.448 1 2124 1 chr2A.!!$F1 2123
9 TraesCS1B01G406000 chr5B 432872129 432874384 2255 False 3589 3589 95.305 1 2273 1 chr5B.!!$F1 2272
10 TraesCS1B01G406000 chr7A 352679787 352681572 1785 True 2737 2737 94.318 484 2273 1 chr7A.!!$R1 1789

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
116 117 2.92429 GGACTCGAAAAACGGATCTGAG 59.076 50.0 9.0 0.0 42.82 3.35 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1885 1904 0.60864 ACTCCTCCGATGCGAAAGTT 59.391 50.0 0.0 0.0 0.0 2.66 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
116 117 2.924290 GGACTCGAAAAACGGATCTGAG 59.076 50.000 9.00 0.0 42.82 3.35
443 444 4.870636 AGGAGACCCATCATTTTGCAATA 58.129 39.130 0.00 0.0 33.88 1.90
881 884 7.418139 CCTTCTATCCAAATCCAATTTGCATCA 60.418 37.037 6.85 0.0 46.27 3.07
1021 1024 9.981460 AATACATGAAAAAGAAAGGAGGTAGAT 57.019 29.630 0.00 0.0 0.00 1.98
1071 1075 5.871396 AAAAAGAAGAAAAGAGGGGTTCC 57.129 39.130 0.00 0.0 0.00 3.62
1495 1509 3.055675 CCCATCAATGCATGGTGTTCTTT 60.056 43.478 0.00 0.0 41.84 2.52
1675 1690 5.720371 AGCAATAACAGTAAATGCACCAA 57.280 34.783 0.00 0.0 39.42 3.67
1789 1804 3.815809 CTTGGACCTTTTATGGCGGATA 58.184 45.455 0.00 0.0 0.00 2.59
1885 1904 4.213906 CAGGTATGCGAATGATGCACAATA 59.786 41.667 0.00 0.0 46.57 1.90
1935 1954 5.125578 CGATCTACCTTATGGATGGATCGAA 59.874 44.000 26.38 0.0 47.00 3.71
2047 2066 7.686434 AGTTGAAGGAGTAGGTTTTATTAGCA 58.314 34.615 0.00 0.0 0.00 3.49
2070 2089 4.043435 AGAGAAGAAGCAGTAAATTGGGGT 59.957 41.667 0.00 0.0 0.00 4.95
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
116 117 4.410492 AGATCGTGCATTTCAGTCAAAC 57.590 40.909 0.00 0.00 0.00 2.93
1053 1057 2.055579 ACGGAACCCCTCTTTTCTTCT 58.944 47.619 0.00 0.00 0.00 2.85
1062 1066 2.510613 TGAAATTCAACGGAACCCCTC 58.489 47.619 0.00 0.00 35.46 4.30
1071 1075 8.682016 GTGAAACTGAATACTTGAAATTCAACG 58.318 33.333 4.03 4.29 41.50 4.10
1243 1248 2.864343 CCCGAATATTCAACTGACCGAC 59.136 50.000 15.57 0.00 0.00 4.79
1333 1347 6.035843 GCGAGGCTCATCAAAATGAAAAATA 58.964 36.000 15.95 0.00 41.33 1.40
1495 1509 3.312697 CCATCGAGAGTAACGATCAGTCA 59.687 47.826 0.00 0.00 46.40 3.41
1789 1804 2.172483 AAAGGAGTCTGTGCGCCGAT 62.172 55.000 4.18 0.00 33.40 4.18
1885 1904 0.608640 ACTCCTCCGATGCGAAAGTT 59.391 50.000 0.00 0.00 0.00 2.66
2047 2066 4.043435 ACCCCAATTTACTGCTTCTTCTCT 59.957 41.667 0.00 0.00 0.00 3.10


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.