Multiple sequence alignment - TraesCS1B01G405700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G405700 chr1B 100.000 2213 0 0 1 2213 633729979 633727767 0.000000e+00 4087.0
1 TraesCS1B01G405700 chr3B 98.014 2216 41 3 1 2213 201561890 201559675 0.000000e+00 3845.0
2 TraesCS1B01G405700 chr3B 97.638 127 3 0 1 127 728215815 728215689 3.700000e-53 219.0
3 TraesCS1B01G405700 chr3B 87.129 101 9 1 55 151 696111671 696111771 6.460000e-21 111.0
4 TraesCS1B01G405700 chr3B 94.000 50 3 0 1 50 647458465 647458514 2.360000e-10 76.8
5 TraesCS1B01G405700 chr3A 96.978 2217 54 7 1 2213 672879542 672877335 0.000000e+00 3711.0
6 TraesCS1B01G405700 chr2D 96.938 2221 36 16 2 2213 272802771 272800574 0.000000e+00 3696.0
7 TraesCS1B01G405700 chr2D 98.082 1616 22 3 600 2213 33933300 33934908 0.000000e+00 2804.0
8 TraesCS1B01G405700 chr5B 96.072 2215 73 6 1 2213 432875617 432877819 0.000000e+00 3596.0
9 TraesCS1B01G405700 chr5B 98.246 513 7 2 1703 2213 413608022 413608534 0.000000e+00 896.0
10 TraesCS1B01G405700 chr5D 95.901 2220 71 13 1 2213 432293826 432291620 0.000000e+00 3578.0
11 TraesCS1B01G405700 chr4A 95.176 2218 91 13 1 2213 310761299 310763505 0.000000e+00 3489.0
12 TraesCS1B01G405700 chr4A 94.497 2217 85 15 1 2213 219340971 219338788 0.000000e+00 3384.0
13 TraesCS1B01G405700 chr4A 94.872 195 8 1 2021 2213 211053416 211053222 9.930000e-79 303.0
14 TraesCS1B01G405700 chr7A 93.961 2219 99 14 1 2213 352678555 352676366 0.000000e+00 3323.0
15 TraesCS1B01G405700 chr7A 94.482 598 24 4 1 596 4701993 4701403 0.000000e+00 913.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G405700 chr1B 633727767 633729979 2212 True 4087 4087 100.000 1 2213 1 chr1B.!!$R1 2212
1 TraesCS1B01G405700 chr3B 201559675 201561890 2215 True 3845 3845 98.014 1 2213 1 chr3B.!!$R1 2212
2 TraesCS1B01G405700 chr3A 672877335 672879542 2207 True 3711 3711 96.978 1 2213 1 chr3A.!!$R1 2212
3 TraesCS1B01G405700 chr2D 272800574 272802771 2197 True 3696 3696 96.938 2 2213 1 chr2D.!!$R1 2211
4 TraesCS1B01G405700 chr2D 33933300 33934908 1608 False 2804 2804 98.082 600 2213 1 chr2D.!!$F1 1613
5 TraesCS1B01G405700 chr5B 432875617 432877819 2202 False 3596 3596 96.072 1 2213 1 chr5B.!!$F2 2212
6 TraesCS1B01G405700 chr5B 413608022 413608534 512 False 896 896 98.246 1703 2213 1 chr5B.!!$F1 510
7 TraesCS1B01G405700 chr5D 432291620 432293826 2206 True 3578 3578 95.901 1 2213 1 chr5D.!!$R1 2212
8 TraesCS1B01G405700 chr4A 310761299 310763505 2206 False 3489 3489 95.176 1 2213 1 chr4A.!!$F1 2212
9 TraesCS1B01G405700 chr4A 219338788 219340971 2183 True 3384 3384 94.497 1 2213 1 chr4A.!!$R2 2212
10 TraesCS1B01G405700 chr7A 352676366 352678555 2189 True 3323 3323 93.961 1 2213 1 chr7A.!!$R2 2212
11 TraesCS1B01G405700 chr7A 4701403 4701993 590 True 913 913 94.482 1 596 1 chr7A.!!$R1 595

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
338 351 7.019774 GCAGAATTGCTCATGAACTAATACA 57.98 36.0 0.0 0.0 46.95 2.29 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1455 1476 0.035056 CCCTCGGAAATGCTCTGGTT 60.035 55.0 0.0 0.0 0.0 3.67 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
31 32 9.449719 AGGAACACTAAAGTACATAAAGGATTG 57.550 33.333 0.00 0.00 0.00 2.67
301 314 8.293027 TCCATTATTTCCTTCCTCTATCCATT 57.707 34.615 0.00 0.00 0.00 3.16
302 315 9.405369 TCCATTATTTCCTTCCTCTATCCATTA 57.595 33.333 0.00 0.00 0.00 1.90
306 319 7.895144 ATTTCCTTCCTCTATCCATTATCCA 57.105 36.000 0.00 0.00 0.00 3.41
307 320 7.895144 TTTCCTTCCTCTATCCATTATCCAT 57.105 36.000 0.00 0.00 0.00 3.41
338 351 7.019774 GCAGAATTGCTCATGAACTAATACA 57.980 36.000 0.00 0.00 46.95 2.29
349 362 8.239681 TCATGAACTAATACACAACTCTTTCG 57.760 34.615 0.00 0.00 0.00 3.46
1392 1413 9.802039 AAGGTACATAGGTCAAAGTTTCATAAA 57.198 29.630 0.00 0.00 0.00 1.40
1557 1578 5.509163 CGATAGATCTACCCGTTGTGGATTT 60.509 44.000 4.10 1.26 44.37 2.17
1748 1769 5.366829 AATTGCTTTAAGTCGGTTACCAC 57.633 39.130 1.13 0.00 0.00 4.16
1794 1815 8.977505 CACAATTCAAACAATTAGGAATTCGTT 58.022 29.630 5.89 0.00 37.75 3.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1239 1260 6.866480 TGAGAGAGCTTTTGTGTTGAAAATT 58.134 32.000 0.00 0.0 0.0 1.82
1392 1413 5.367945 ACGATTTGTGTGGGATAAGGTAT 57.632 39.130 0.00 0.0 0.0 2.73
1455 1476 0.035056 CCCTCGGAAATGCTCTGGTT 60.035 55.000 0.00 0.0 0.0 3.67
1628 1649 2.548057 AGTACTCAACACAATTGCCACG 59.452 45.455 5.05 0.0 0.0 4.94


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.