Multiple sequence alignment - TraesCS1B01G405600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G405600 chr1B 100.000 2543 0 0 1 2543 633729669 633727127 0 4697
1 TraesCS1B01G405600 chr3B 97.917 2545 51 2 1 2543 201561579 201559035 0 4405
2 TraesCS1B01G405600 chr3B 95.729 960 36 4 1 955 703008363 703007404 0 1541
3 TraesCS1B01G405600 chr3A 97.406 2544 62 4 1 2543 672879236 672876696 0 4329
4 TraesCS1B01G405600 chr5D 96.548 2549 77 10 1 2543 432293524 432290981 0 4209
5 TraesCS1B01G405600 chr5B 96.189 2545 81 5 1 2543 432875920 432878450 0 4148
6 TraesCS1B01G405600 chr5B 97.662 1155 23 3 1393 2543 413608022 413609176 0 1980
7 TraesCS1B01G405600 chr4A 95.838 2547 100 5 1 2543 310761601 310764145 0 4111
8 TraesCS1B01G405600 chr2D 98.095 2257 33 4 290 2543 33933300 33935549 0 3921
9 TraesCS1B01G405600 chr2D 97.327 1983 33 7 1 1977 272802468 272800500 0 3350
10 TraesCS1B01G405600 chr2D 97.712 1792 32 3 754 2543 630270241 630272025 0 3073
11 TraesCS1B01G405600 chr2D 98.336 1502 21 1 1 1498 630268419 630269920 0 2632
12 TraesCS1B01G405600 chr4D 95.895 1559 62 2 986 2543 245648863 245650420 0 2523


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G405600 chr1B 633727127 633729669 2542 True 4697.0 4697 100.000 1 2543 1 chr1B.!!$R1 2542
1 TraesCS1B01G405600 chr3B 201559035 201561579 2544 True 4405.0 4405 97.917 1 2543 1 chr3B.!!$R1 2542
2 TraesCS1B01G405600 chr3B 703007404 703008363 959 True 1541.0 1541 95.729 1 955 1 chr3B.!!$R2 954
3 TraesCS1B01G405600 chr3A 672876696 672879236 2540 True 4329.0 4329 97.406 1 2543 1 chr3A.!!$R1 2542
4 TraesCS1B01G405600 chr5D 432290981 432293524 2543 True 4209.0 4209 96.548 1 2543 1 chr5D.!!$R1 2542
5 TraesCS1B01G405600 chr5B 432875920 432878450 2530 False 4148.0 4148 96.189 1 2543 1 chr5B.!!$F2 2542
6 TraesCS1B01G405600 chr5B 413608022 413609176 1154 False 1980.0 1980 97.662 1393 2543 1 chr5B.!!$F1 1150
7 TraesCS1B01G405600 chr4A 310761601 310764145 2544 False 4111.0 4111 95.838 1 2543 1 chr4A.!!$F1 2542
8 TraesCS1B01G405600 chr2D 33933300 33935549 2249 False 3921.0 3921 98.095 290 2543 1 chr2D.!!$F1 2253
9 TraesCS1B01G405600 chr2D 272800500 272802468 1968 True 3350.0 3350 97.327 1 1977 1 chr2D.!!$R1 1976
10 TraesCS1B01G405600 chr2D 630268419 630272025 3606 False 2852.5 3073 98.024 1 2543 2 chr2D.!!$F2 2542
11 TraesCS1B01G405600 chr4D 245648863 245650420 1557 False 2523.0 2523 95.895 986 2543 1 chr4D.!!$F1 1557

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
175 176 5.819901 AGCGCTTTTTCTTATTCTAGCAGAT 59.180 36.00 2.64 0.0 0.0 2.9 F
1082 2157 9.802039 AAGGTACATAGGTCAAAGTTTCATAAA 57.198 29.63 0.00 0.0 0.0 1.4 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1145 2220 0.035056 CCCTCGGAAATGCTCTGGTT 60.035 55.000 0.00 0.0 0.00 3.67 R
2141 3236 4.765856 ACCACGATGTATCTGGGATAGTAC 59.234 45.833 12.06 0.0 32.74 2.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
28 29 7.019774 GCAGAATTGCTCATGAACTAATACA 57.980 36.000 0.00 0.00 46.95 2.29
39 40 8.239681 TCATGAACTAATACACAACTCTTTCG 57.760 34.615 0.00 0.00 0.00 3.46
175 176 5.819901 AGCGCTTTTTCTTATTCTAGCAGAT 59.180 36.000 2.64 0.00 0.00 2.90
1082 2157 9.802039 AAGGTACATAGGTCAAAGTTTCATAAA 57.198 29.630 0.00 0.00 0.00 1.40
1247 2322 5.509163 CGATAGATCTACCCGTTGTGGATTT 60.509 44.000 4.10 1.26 44.37 2.17
1484 2559 8.977505 CACAATTCAAACAATTAGGAATTCGTT 58.022 29.630 5.89 0.00 37.75 3.85
1987 3082 4.569761 TCCTACTTTGTAGCTATCGCAG 57.430 45.455 0.00 0.00 39.10 5.18
2112 3207 3.162666 AGATGGGTTCACTTCACTCGTA 58.837 45.455 0.00 0.00 0.00 3.43
2328 3423 2.434336 AGGTGCAATTACTATGGCTCGA 59.566 45.455 0.00 0.00 31.51 4.04
2515 3610 5.506317 CGGTTCAATTCTTGCCCTCATATTC 60.506 44.000 0.00 0.00 0.00 1.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
175 176 7.614192 GTCCTAAATTAGACCAAAGGAATTCCA 59.386 37.037 26.22 2.43 38.89 3.53
929 2004 6.866480 TGAGAGAGCTTTTGTGTTGAAAATT 58.134 32.000 0.00 0.00 0.00 1.82
1082 2157 5.367945 ACGATTTGTGTGGGATAAGGTAT 57.632 39.130 0.00 0.00 0.00 2.73
1145 2220 0.035056 CCCTCGGAAATGCTCTGGTT 60.035 55.000 0.00 0.00 0.00 3.67
1154 2229 1.005924 AGTGGATTTGCCCTCGGAAAT 59.994 47.619 0.00 0.00 34.97 2.17
1318 2393 2.548057 AGTACTCAACACAATTGCCACG 59.452 45.455 5.05 0.00 0.00 4.94
1987 3082 5.885912 TGGCTCCCACATAAATAAGAAGTTC 59.114 40.000 0.00 0.00 0.00 3.01
2141 3236 4.765856 ACCACGATGTATCTGGGATAGTAC 59.234 45.833 12.06 0.00 32.74 2.73
2206 3301 9.967451 TTGTTGAACATTATTTATGAGACCCTA 57.033 29.630 0.00 0.00 37.69 3.53
2515 3610 8.375608 ACTCCTTATCAATCTCGATTCATTTG 57.624 34.615 0.00 0.00 0.00 2.32


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.