Multiple sequence alignment - TraesCS1B01G405400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G405400 chr1B 100.000 2321 0 0 1 2321 633728122 633725802 0 4287
1 TraesCS1B01G405400 chr5B 98.012 1308 22 3 1 1304 413608177 413609484 0 2268
2 TraesCS1B01G405400 chr3B 97.779 1306 26 3 1 1304 201560032 201558728 0 2248
3 TraesCS1B01G405400 chr3B 98.535 1024 12 3 1299 2321 201504330 201503309 0 1805
4 TraesCS1B01G405400 chr3B 93.385 1028 52 8 1299 2321 460160639 460161655 0 1507
5 TraesCS1B01G405400 chr2D 97.781 1307 19 4 1 1304 33934558 33935857 0 2244
6 TraesCS1B01G405400 chr2D 97.703 1306 21 3 1 1304 630271035 630272333 0 2237
7 TraesCS1B01G405400 chr2D 98.730 1024 12 1 1299 2321 28724875 28723852 0 1818
8 TraesCS1B01G405400 chr3A 97.625 1305 28 3 1 1304 672877690 672876388 0 2235
9 TraesCS1B01G405400 chr4D 96.475 1305 43 3 1 1304 245649425 245650727 0 2152
10 TraesCS1B01G405400 chr5D 96.330 1308 41 7 1 1304 432291978 432290674 0 2143
11 TraesCS1B01G405400 chr5D 97.951 1025 15 4 1299 2321 483797802 483798822 0 1772
12 TraesCS1B01G405400 chr5D 97.559 1024 23 2 1299 2321 6209890 6210912 0 1751
13 TraesCS1B01G405400 chrUn 98.346 1209 17 3 99 1304 371049286 371050494 0 2119
14 TraesCS1B01G405400 chr4A 95.712 1306 51 5 1 1304 310763148 310764450 0 2097
15 TraesCS1B01G405400 chr1A 98.730 1024 12 1 1299 2321 554467271 554468294 0 1818
16 TraesCS1B01G405400 chr1A 95.415 1025 42 5 1299 2321 154077754 154076733 0 1628
17 TraesCS1B01G405400 chr6B 98.033 966 13 4 1299 2262 579205896 579206857 0 1674
18 TraesCS1B01G405400 chr1D 93.951 1025 37 10 1299 2321 244406388 244405387 0 1526


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G405400 chr1B 633725802 633728122 2320 True 4287 4287 100.000 1 2321 1 chr1B.!!$R1 2320
1 TraesCS1B01G405400 chr5B 413608177 413609484 1307 False 2268 2268 98.012 1 1304 1 chr5B.!!$F1 1303
2 TraesCS1B01G405400 chr3B 201558728 201560032 1304 True 2248 2248 97.779 1 1304 1 chr3B.!!$R2 1303
3 TraesCS1B01G405400 chr3B 201503309 201504330 1021 True 1805 1805 98.535 1299 2321 1 chr3B.!!$R1 1022
4 TraesCS1B01G405400 chr3B 460160639 460161655 1016 False 1507 1507 93.385 1299 2321 1 chr3B.!!$F1 1022
5 TraesCS1B01G405400 chr2D 33934558 33935857 1299 False 2244 2244 97.781 1 1304 1 chr2D.!!$F1 1303
6 TraesCS1B01G405400 chr2D 630271035 630272333 1298 False 2237 2237 97.703 1 1304 1 chr2D.!!$F2 1303
7 TraesCS1B01G405400 chr2D 28723852 28724875 1023 True 1818 1818 98.730 1299 2321 1 chr2D.!!$R1 1022
8 TraesCS1B01G405400 chr3A 672876388 672877690 1302 True 2235 2235 97.625 1 1304 1 chr3A.!!$R1 1303
9 TraesCS1B01G405400 chr4D 245649425 245650727 1302 False 2152 2152 96.475 1 1304 1 chr4D.!!$F1 1303
10 TraesCS1B01G405400 chr5D 432290674 432291978 1304 True 2143 2143 96.330 1 1304 1 chr5D.!!$R1 1303
11 TraesCS1B01G405400 chr5D 483797802 483798822 1020 False 1772 1772 97.951 1299 2321 1 chr5D.!!$F2 1022
12 TraesCS1B01G405400 chr5D 6209890 6210912 1022 False 1751 1751 97.559 1299 2321 1 chr5D.!!$F1 1022
13 TraesCS1B01G405400 chrUn 371049286 371050494 1208 False 2119 2119 98.346 99 1304 1 chrUn.!!$F1 1205
14 TraesCS1B01G405400 chr4A 310763148 310764450 1302 False 2097 2097 95.712 1 1304 1 chr4A.!!$F1 1303
15 TraesCS1B01G405400 chr1A 554467271 554468294 1023 False 1818 1818 98.730 1299 2321 1 chr1A.!!$F1 1022
16 TraesCS1B01G405400 chr1A 154076733 154077754 1021 True 1628 1628 95.415 1299 2321 1 chr1A.!!$R1 1022
17 TraesCS1B01G405400 chr6B 579205896 579206857 961 False 1674 1674 98.033 1299 2262 1 chr6B.!!$F1 963
18 TraesCS1B01G405400 chr1D 244405387 244406388 1001 True 1526 1526 93.951 1299 2321 1 chr1D.!!$R1 1022

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
781 795 2.434336 AGGTGCAATTACTATGGCTCGA 59.566 45.455 0.0 0.0 31.51 4.04 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1949 1971 1.366366 CCGCCCGATCGTATTTCCT 59.634 57.895 15.09 0.0 0.0 3.36 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
440 454 4.569761 TCCTACTTTGTAGCTATCGCAG 57.430 45.455 0.00 0.0 39.10 5.18
565 579 3.162666 AGATGGGTTCACTTCACTCGTA 58.837 45.455 0.00 0.0 0.00 3.43
781 795 2.434336 AGGTGCAATTACTATGGCTCGA 59.566 45.455 0.00 0.0 31.51 4.04
968 983 5.506317 CGGTTCAATTCTTGCCCTCATATTC 60.506 44.000 0.00 0.0 0.00 1.75
1447 1464 4.039004 ACTTGTGCCAAAATAACTGATGCA 59.961 37.500 0.00 0.0 0.00 3.96
1476 1493 1.535462 CAAAAGGCCTTGGACACGTAG 59.465 52.381 21.33 0.0 0.00 3.51
1498 1515 1.943340 GGATCCTGAAGCACGATTTCC 59.057 52.381 3.84 0.0 0.00 3.13
1502 1519 2.276680 GAAGCACGATTTCCGCGC 60.277 61.111 0.00 0.0 45.81 6.86
1761 1782 4.418526 AGGATAGATCTGTCCTCTTCCTCA 59.581 45.833 29.91 0.0 46.49 3.86
1888 1909 4.141482 GGAACAGGGCCTATCACAAGAATA 60.141 45.833 5.28 0.0 0.00 1.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
440 454 5.885912 TGGCTCCCACATAAATAAGAAGTTC 59.114 40.000 0.00 0.00 0.00 3.01
594 608 4.765856 ACCACGATGTATCTGGGATAGTAC 59.234 45.833 12.06 0.00 32.74 2.73
659 673 9.967451 TTGTTGAACATTATTTATGAGACCCTA 57.033 29.630 0.00 0.00 37.69 3.53
968 983 8.375608 ACTCCTTATCAATCTCGATTCATTTG 57.624 34.615 0.00 0.00 0.00 2.32
1049 1064 5.934043 CGGCTTGTGATCAATCCATAGATAA 59.066 40.000 0.00 0.00 39.11 1.75
1441 1458 4.370917 GCCTTTTGTTCTTCTTTGCATCA 58.629 39.130 0.00 0.00 0.00 3.07
1447 1464 4.030216 TCCAAGGCCTTTTGTTCTTCTTT 58.970 39.130 17.61 0.00 0.00 2.52
1476 1493 2.029838 AATCGTGCTTCAGGATCCAC 57.970 50.000 15.82 0.54 37.89 4.02
1949 1971 1.366366 CCGCCCGATCGTATTTCCT 59.634 57.895 15.09 0.00 0.00 3.36


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.