Multiple sequence alignment - TraesCS1B01G405300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G405300 chr1B 100.000 2312 0 0 1 2312 633722225 633719914 0 4270
1 TraesCS1B01G405300 chr1B 97.349 2263 44 10 1 2252 633752670 633750413 0 3832
2 TraesCS1B01G405300 chr2B 97.849 2325 33 9 1 2312 683732673 683730353 0 4000
3 TraesCS1B01G405300 chr3A 97.717 2322 39 6 2 2312 105551730 105554048 0 3982
4 TraesCS1B01G405300 chr5D 97.330 2322 48 6 1 2312 6248047 6250364 0 3932
5 TraesCS1B01G405300 chr5D 97.158 2322 48 9 1 2312 503318727 503316414 0 3906
6 TraesCS1B01G405300 chr1D 97.161 2325 51 8 1 2312 254464635 254462313 0 3914
7 TraesCS1B01G405300 chr1D 96.384 2323 60 12 1 2312 51826745 51829054 0 3803
8 TraesCS1B01G405300 chr4A 96.298 2323 69 9 1 2312 309405382 309407698 0 3797
9 TraesCS1B01G405300 chr7A 96.248 2319 63 11 3 2312 537836197 537838500 0 3779
10 TraesCS1B01G405300 chr3B 95.478 1150 45 2 1166 2308 412649735 412648586 0 1829


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G405300 chr1B 633719914 633722225 2311 True 4270 4270 100.000 1 2312 1 chr1B.!!$R1 2311
1 TraesCS1B01G405300 chr1B 633750413 633752670 2257 True 3832 3832 97.349 1 2252 1 chr1B.!!$R2 2251
2 TraesCS1B01G405300 chr2B 683730353 683732673 2320 True 4000 4000 97.849 1 2312 1 chr2B.!!$R1 2311
3 TraesCS1B01G405300 chr3A 105551730 105554048 2318 False 3982 3982 97.717 2 2312 1 chr3A.!!$F1 2310
4 TraesCS1B01G405300 chr5D 6248047 6250364 2317 False 3932 3932 97.330 1 2312 1 chr5D.!!$F1 2311
5 TraesCS1B01G405300 chr5D 503316414 503318727 2313 True 3906 3906 97.158 1 2312 1 chr5D.!!$R1 2311
6 TraesCS1B01G405300 chr1D 254462313 254464635 2322 True 3914 3914 97.161 1 2312 1 chr1D.!!$R1 2311
7 TraesCS1B01G405300 chr1D 51826745 51829054 2309 False 3803 3803 96.384 1 2312 1 chr1D.!!$F1 2311
8 TraesCS1B01G405300 chr4A 309405382 309407698 2316 False 3797 3797 96.298 1 2312 1 chr4A.!!$F1 2311
9 TraesCS1B01G405300 chr7A 537836197 537838500 2303 False 3779 3779 96.248 3 2312 1 chr7A.!!$F1 2309
10 TraesCS1B01G405300 chr3B 412648586 412649735 1149 True 1829 1829 95.478 1166 2308 1 chr3B.!!$R1 1142

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
272 274 0.322456 AAGGGCGCTTTAGATGCACA 60.322 50.0 10.73 0.0 33.47 4.57 F
1039 1049 1.924731 TTCAGAGGGAGAAGAAGCGA 58.075 50.0 0.00 0.0 0.00 4.93 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1244 1256 1.511850 TTCTCGAAGTACGTGTCCGA 58.488 50.000 0.0 1.02 43.13 4.55 R
2225 2254 3.664107 TCAATTCGCAGAGTTACAAGCT 58.336 40.909 0.0 0.00 32.99 3.74 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
272 274 0.322456 AAGGGCGCTTTAGATGCACA 60.322 50.000 10.73 0.0 33.47 4.57
328 330 7.696992 TTTGGATATAGTTTTCCTTGTGACC 57.303 36.000 0.00 0.0 32.95 4.02
392 394 6.451393 ACGCATTTTATTTGGCAGTTTTCTA 58.549 32.000 0.00 0.0 0.00 2.10
434 436 6.070710 GGGTGGGTTACTTTTTATTGGCATTA 60.071 38.462 0.00 0.0 0.00 1.90
623 625 3.737559 TGGACATCTTGTTTGGGCTAT 57.262 42.857 0.00 0.0 0.00 2.97
650 652 7.398618 TGGATTTATGTTCTTAATTTCCTGGCA 59.601 33.333 0.00 0.0 0.00 4.92
1007 1016 2.556189 AGCAACGACACATTATGGCAAA 59.444 40.909 0.00 0.0 35.12 3.68
1039 1049 1.924731 TTCAGAGGGAGAAGAAGCGA 58.075 50.000 0.00 0.0 0.00 4.93
1244 1256 6.204882 GCTAACTATCGACATTTTGGGCTATT 59.795 38.462 0.00 0.0 0.00 1.73
1328 1340 9.031537 CAGTTGGTAAGGATAAAATACCCTTTT 57.968 33.333 0.00 0.0 40.47 2.27
1971 2000 1.796796 GCTTGCTCGGTGAATGTCC 59.203 57.895 0.00 0.0 0.00 4.02
2135 2164 0.622665 CCACTGGGAGAGGATTTGCT 59.377 55.000 0.00 0.0 35.59 3.91
2225 2254 1.602668 GCAGAGGCGAATTGTGCAAAA 60.603 47.619 0.00 0.0 34.18 2.44
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
168 169 7.681168 TCCCTAGGTCCTATTGTTAAGAAAAGA 59.319 37.037 8.29 0.00 0.00 2.52
272 274 1.474879 CCGGCATTAATTTGGAACCGT 59.525 47.619 0.00 0.00 37.51 4.83
434 436 5.771666 CCCTGCCATAATGTGATATGTTTCT 59.228 40.000 0.00 0.00 32.48 2.52
623 625 8.257306 GCCAGGAAATTAAGAACATAAATCCAA 58.743 33.333 0.00 0.00 31.89 3.53
650 652 4.832560 ATTAATTCCTGCCAATACCCCT 57.167 40.909 0.00 0.00 0.00 4.79
698 700 7.120726 AGCGAATTAAATTAGCTAAAGGTGTGT 59.879 33.333 10.85 0.00 46.96 3.72
955 962 9.592196 TTACCAAGTATACGGTTCTAATCCTAT 57.408 33.333 7.63 0.00 36.69 2.57
1244 1256 1.511850 TTCTCGAAGTACGTGTCCGA 58.488 50.000 0.00 1.02 43.13 4.55
1328 1340 9.473007 TCAATTCCAGAAATCCATACAAATACA 57.527 29.630 0.00 0.00 0.00 2.29
1363 1375 3.054065 CAGAATGGTAAAGAGGGCTCCTT 60.054 47.826 0.00 0.00 31.76 3.36
2135 2164 4.843516 AGGGAATTGCTTAAACAATCCCAA 59.156 37.500 25.08 5.19 43.08 4.12
2225 2254 3.664107 TCAATTCGCAGAGTTACAAGCT 58.336 40.909 0.00 0.00 32.99 3.74


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.