Multiple sequence alignment - TraesCS1B01G404900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G404900 chr1B 100.000 2246 0 0 1 2246 633715629 633717874 0 4148
1 TraesCS1B01G404900 chr3A 98.890 2252 19 3 1 2246 105558305 105556054 0 4015
2 TraesCS1B01G404900 chr7B 98.711 2249 25 4 1 2246 662756377 662754130 0 3989
3 TraesCS1B01G404900 chr5B 98.535 2252 27 5 1 2246 57516471 57514220 0 3971
4 TraesCS1B01G404900 chr5D 98.007 2258 31 5 1 2246 6254628 6252373 0 3908
5 TraesCS1B01G404900 chr5D 98.046 2252 34 8 1 2246 503338095 503340342 0 3906
6 TraesCS1B01G404900 chr5D 97.688 2249 39 7 1 2244 503312160 503314400 0 3853
7 TraesCS1B01G404900 chr5D 98.442 2182 22 4 69 2243 299973782 299971606 0 3831
8 TraesCS1B01G404900 chr1D 97.647 2252 36 9 1 2246 254458073 254460313 0 3849
9 TraesCS1B01G404900 chr1D 97.112 2251 50 10 1 2246 51833303 51831063 0 3783


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G404900 chr1B 633715629 633717874 2245 False 4148 4148 100.000 1 2246 1 chr1B.!!$F1 2245
1 TraesCS1B01G404900 chr3A 105556054 105558305 2251 True 4015 4015 98.890 1 2246 1 chr3A.!!$R1 2245
2 TraesCS1B01G404900 chr7B 662754130 662756377 2247 True 3989 3989 98.711 1 2246 1 chr7B.!!$R1 2245
3 TraesCS1B01G404900 chr5B 57514220 57516471 2251 True 3971 3971 98.535 1 2246 1 chr5B.!!$R1 2245
4 TraesCS1B01G404900 chr5D 6252373 6254628 2255 True 3908 3908 98.007 1 2246 1 chr5D.!!$R1 2245
5 TraesCS1B01G404900 chr5D 503338095 503340342 2247 False 3906 3906 98.046 1 2246 1 chr5D.!!$F2 2245
6 TraesCS1B01G404900 chr5D 503312160 503314400 2240 False 3853 3853 97.688 1 2244 1 chr5D.!!$F1 2243
7 TraesCS1B01G404900 chr5D 299971606 299973782 2176 True 3831 3831 98.442 69 2243 1 chr5D.!!$R2 2174
8 TraesCS1B01G404900 chr1D 254458073 254460313 2240 False 3849 3849 97.647 1 2246 1 chr1D.!!$F1 2245
9 TraesCS1B01G404900 chr1D 51831063 51833303 2240 True 3783 3783 97.112 1 2246 1 chr1D.!!$R1 2245

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
854 875 6.884472 TGGAATTCCCTTCTATGTAGTTCA 57.116 37.5 21.9 0.0 34.08 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1791 1818 6.93296 ACACCAACCACTACAGTTAGATTTAC 59.067 38.462 0.0 0.0 0.0 2.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
261 263 8.237267 CCATTATCACTTAGCTTTCGACTTTTT 58.763 33.333 0.00 0.0 0.00 1.94
392 394 8.359642 TCAAGCTCTTATTTTTGCAACATTAGT 58.640 29.630 0.00 0.0 0.00 2.24
674 681 7.844779 TCCTTAATGTCTATAAGTGGAGTCCTT 59.155 37.037 11.33 0.0 0.00 3.36
854 875 6.884472 TGGAATTCCCTTCTATGTAGTTCA 57.116 37.500 21.90 0.0 34.08 3.18
1019 1040 4.641541 CACCATGAATCCACTAATTGCTGA 59.358 41.667 0.00 0.0 0.00 4.26
1123 1144 3.067461 AGCTGTAGAAGGTATTGCGAGAG 59.933 47.826 0.00 0.0 33.90 3.20
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
150 151 6.094048 TCTCGAAATAGCTCAATCCTTTTTGG 59.906 38.462 0.0 0.0 37.10 3.28
261 263 4.649267 TTCATCCGCCAATATATTCCCA 57.351 40.909 0.0 0.0 0.00 4.37
674 681 4.674281 AAAGTGGAAACCCGCATAAAAA 57.326 36.364 0.0 0.0 36.68 1.94
1019 1040 2.426024 CCAGCAGCAATAACAGAAGCAT 59.574 45.455 0.0 0.0 0.00 3.79
1123 1144 2.770164 TTACCTTCTGCTTCTGGCTC 57.230 50.000 0.0 0.0 42.39 4.70
1791 1818 6.932960 ACACCAACCACTACAGTTAGATTTAC 59.067 38.462 0.0 0.0 0.00 2.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.