Multiple sequence alignment - TraesCS1B01G404800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G404800 chr1B 100.000 2174 0 0 1 2174 633716967 633714794 0.000000e+00 4015
1 TraesCS1B01G404800 chr3A 98.763 2183 18 4 1 2174 105556961 105559143 0.000000e+00 3873
2 TraesCS1B01G404800 chr5D 98.258 2181 29 5 1 2174 503339436 503337258 0.000000e+00 3808
3 TraesCS1B01G404800 chr5D 97.845 2181 35 5 1 2174 503313498 503311323 0.000000e+00 3757
4 TraesCS1B01G404800 chr5D 97.620 2185 25 4 1 2174 6253280 6255448 0.000000e+00 3722
5 TraesCS1B01G404800 chr3B 99.009 2119 16 4 1 2114 101924872 101922754 0.000000e+00 3792
6 TraesCS1B01G404800 chr1D 97.522 2179 44 6 1 2174 51831964 51834137 0.000000e+00 3716
7 TraesCS1B01G404800 chr1D 97.244 2177 31 7 1 2174 254459404 254457254 0.000000e+00 3661
8 TraesCS1B01G404800 chr7B 98.527 2036 26 4 1 2034 662755039 662757072 0.000000e+00 3591
9 TraesCS1B01G404800 chr1A 98.706 2009 21 3 171 2174 554482083 554480075 0.000000e+00 3561
10 TraesCS1B01G404800 chr7A 94.586 665 14 5 1512 2174 537849192 537848548 0.000000e+00 1009
11 TraesCS1B01G404800 chr2B 95.224 335 15 1 1793 2126 298532914 298532580 1.480000e-146 529


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G404800 chr1B 633714794 633716967 2173 True 4015 4015 100.000 1 2174 1 chr1B.!!$R1 2173
1 TraesCS1B01G404800 chr3A 105556961 105559143 2182 False 3873 3873 98.763 1 2174 1 chr3A.!!$F1 2173
2 TraesCS1B01G404800 chr5D 503337258 503339436 2178 True 3808 3808 98.258 1 2174 1 chr5D.!!$R2 2173
3 TraesCS1B01G404800 chr5D 503311323 503313498 2175 True 3757 3757 97.845 1 2174 1 chr5D.!!$R1 2173
4 TraesCS1B01G404800 chr5D 6253280 6255448 2168 False 3722 3722 97.620 1 2174 1 chr5D.!!$F1 2173
5 TraesCS1B01G404800 chr3B 101922754 101924872 2118 True 3792 3792 99.009 1 2114 1 chr3B.!!$R1 2113
6 TraesCS1B01G404800 chr1D 51831964 51834137 2173 False 3716 3716 97.522 1 2174 1 chr1D.!!$F1 2173
7 TraesCS1B01G404800 chr1D 254457254 254459404 2150 True 3661 3661 97.244 1 2174 1 chr1D.!!$R1 2173
8 TraesCS1B01G404800 chr7B 662755039 662757072 2033 False 3591 3591 98.527 1 2034 1 chr7B.!!$F1 2033
9 TraesCS1B01G404800 chr1A 554480075 554482083 2008 True 3561 3561 98.706 171 2174 1 chr1A.!!$R1 2003
10 TraesCS1B01G404800 chr7A 537848548 537849192 644 True 1009 1009 94.586 1512 2174 1 chr7A.!!$R1 662

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
319 323 2.426024 CCAGCAGCAATAACAGAAGCAT 59.574 45.455 0.0 0.0 0.0 3.79 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1925 1952 5.477637 AGGGCCGTTCTCTCTATATAAGAAC 59.522 44.0 12.79 12.79 43.42 3.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
215 219 2.770164 TTACCTTCTGCTTCTGGCTC 57.230 50.000 0.0 0.0 42.39 4.70
319 323 2.426024 CCAGCAGCAATAACAGAAGCAT 59.574 45.455 0.0 0.0 0.00 3.79
664 679 4.674281 AAAGTGGAAACCCGCATAAAAA 57.326 36.364 0.0 0.0 36.68 1.94
1077 1098 4.649267 TTCATCCGCCAATATATTCCCA 57.351 40.909 0.0 0.0 0.00 4.37
1187 1208 7.076842 TCTCGAAATAGCTCAATCCTTTTTG 57.923 36.000 0.0 0.0 0.00 2.44
1888 1915 8.952278 AGTAAGTGATTCCATAAATTTACGCAA 58.048 29.630 0.0 0.0 0.00 4.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
215 219 3.067461 AGCTGTAGAAGGTATTGCGAGAG 59.933 47.826 0.00 0.00 33.90 3.20
319 323 4.641541 CACCATGAATCCACTAATTGCTGA 59.358 41.667 0.00 0.00 0.00 4.26
664 679 7.844779 TCCTTAATGTCTATAAGTGGAGTCCTT 59.155 37.037 11.33 0.00 0.00 3.36
1077 1098 8.237267 CCATTATCACTTAGCTTTCGACTTTTT 58.763 33.333 0.00 0.00 0.00 1.94
1371 1393 6.614906 ACTCAGATTGGAGAAGAATATGGTCT 59.385 38.462 0.00 0.00 38.30 3.85
1925 1952 5.477637 AGGGCCGTTCTCTCTATATAAGAAC 59.522 44.000 12.79 12.79 43.42 3.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.