Multiple sequence alignment - TraesCS1B01G404700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G404700 chr1B 100.000 2591 0 0 1 2591 633714202 633716792 0.000000e+00 4785.0
1 TraesCS1B01G404700 chr3A 98.731 2600 24 4 1 2591 105559736 105557137 0.000000e+00 4610.0
2 TraesCS1B01G404700 chr1A 98.730 2598 26 5 1 2591 554479481 554482078 0.000000e+00 4608.0
3 TraesCS1B01G404700 chr1A 98.729 236 3 0 1 236 393046819 393047054 1.110000e-113 420.0
4 TraesCS1B01G404700 chr5D 97.818 2567 44 5 33 2591 503310762 503313324 0.000000e+00 4420.0
5 TraesCS1B01G404700 chr5D 97.661 2565 32 5 39 2591 6256002 6253454 0.000000e+00 4379.0
6 TraesCS1B01G404700 chr5D 98.413 2457 33 4 138 2588 503336802 503339258 0.000000e+00 4316.0
7 TraesCS1B01G404700 chr5D 98.187 1875 20 5 414 2279 481595400 481597269 0.000000e+00 3262.0
8 TraesCS1B01G404700 chr1D 97.343 2597 54 11 1 2591 51834726 51832139 0.000000e+00 4399.0
9 TraesCS1B01G404700 chr3B 98.971 1943 16 3 653 2591 101922754 101924696 0.000000e+00 3474.0
10 TraesCS1B01G404700 chr7B 98.442 1861 25 4 733 2591 662757072 662755214 0.000000e+00 3273.0
11 TraesCS1B01G404700 chr4D 96.804 1752 51 5 1 1749 19887691 19889440 0.000000e+00 2920.0
12 TraesCS1B01G404700 chr6A 92.683 82 5 1 32 112 3300777 3300858 1.630000e-22 117.0
13 TraesCS1B01G404700 chr2D 95.455 44 2 0 1 44 383359926 383359969 1.290000e-08 71.3


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G404700 chr1B 633714202 633716792 2590 False 4785 4785 100.000 1 2591 1 chr1B.!!$F1 2590
1 TraesCS1B01G404700 chr3A 105557137 105559736 2599 True 4610 4610 98.731 1 2591 1 chr3A.!!$R1 2590
2 TraesCS1B01G404700 chr1A 554479481 554482078 2597 False 4608 4608 98.730 1 2591 1 chr1A.!!$F2 2590
3 TraesCS1B01G404700 chr5D 503310762 503313324 2562 False 4420 4420 97.818 33 2591 1 chr5D.!!$F2 2558
4 TraesCS1B01G404700 chr5D 6253454 6256002 2548 True 4379 4379 97.661 39 2591 1 chr5D.!!$R1 2552
5 TraesCS1B01G404700 chr5D 503336802 503339258 2456 False 4316 4316 98.413 138 2588 1 chr5D.!!$F3 2450
6 TraesCS1B01G404700 chr5D 481595400 481597269 1869 False 3262 3262 98.187 414 2279 1 chr5D.!!$F1 1865
7 TraesCS1B01G404700 chr1D 51832139 51834726 2587 True 4399 4399 97.343 1 2591 1 chr1D.!!$R1 2590
8 TraesCS1B01G404700 chr3B 101922754 101924696 1942 False 3474 3474 98.971 653 2591 1 chr3B.!!$F1 1938
9 TraesCS1B01G404700 chr7B 662755214 662757072 1858 True 3273 3273 98.442 733 2591 1 chr7B.!!$R1 1858
10 TraesCS1B01G404700 chr4D 19887691 19889440 1749 False 2920 2920 96.804 1 1749 1 chr4D.!!$F1 1748

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
840 843 5.477637 AGGGCCGTTCTCTCTATATAAGAAC 59.522 44.0 12.79 12.79 43.42 3.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2446 2480 2.426024 CCAGCAGCAATAACAGAAGCAT 59.574 45.455 0.0 0.0 0.0 3.79 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
354 356 6.039829 AGCAAGTCAGGGAAAAAGTTTCTTAG 59.960 38.462 1.11 0.00 0.00 2.18
515 518 7.961325 AGAGACTTAAGAGCAGAAGAAAAAG 57.039 36.000 10.09 0.00 0.00 2.27
840 843 5.477637 AGGGCCGTTCTCTCTATATAAGAAC 59.522 44.000 12.79 12.79 43.42 3.01
1394 1403 6.614906 ACTCAGATTGGAGAAGAATATGGTCT 59.385 38.462 0.00 0.00 38.30 3.85
1688 1698 8.237267 CCATTATCACTTAGCTTTCGACTTTTT 58.763 33.333 0.00 0.00 0.00 1.94
2101 2125 7.844779 TCCTTAATGTCTATAAGTGGAGTCCTT 59.155 37.037 11.33 0.00 0.00 3.36
2446 2480 4.641541 CACCATGAATCCACTAATTGCTGA 59.358 41.667 0.00 0.00 0.00 4.26
2550 2584 3.067461 AGCTGTAGAAGGTATTGCGAGAG 59.933 47.826 0.00 0.00 33.90 3.20
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
244 246 2.224329 TGAGTACCTTTACGCTTTGCCA 60.224 45.455 0.0 0.0 32.93 4.92
877 880 8.952278 AGTAAGTGATTCCATAAATTTACGCAA 58.048 29.630 0.0 0.0 0.00 4.85
1577 1586 6.094048 TCTCGAAATAGCTCAATCCTTTTTGG 59.906 38.462 0.0 0.0 37.10 3.28
1688 1698 4.649267 TTCATCCGCCAATATATTCCCA 57.351 40.909 0.0 0.0 0.00 4.37
2101 2125 4.674281 AAAGTGGAAACCCGCATAAAAA 57.326 36.364 0.0 0.0 36.68 1.94
2446 2480 2.426024 CCAGCAGCAATAACAGAAGCAT 59.574 45.455 0.0 0.0 0.00 3.79
2550 2584 2.770164 TTACCTTCTGCTTCTGGCTC 57.230 50.000 0.0 0.0 42.39 4.70


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.