Multiple sequence alignment - TraesCS1B01G404600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G404600 chr1B 100.000 2157 0 0 1 2157 633710909 633708753 0.000000e+00 3984
1 TraesCS1B01G404600 chr2D 98.321 1489 22 3 669 2157 638427051 638425566 0.000000e+00 2608
2 TraesCS1B01G404600 chr1D 97.717 1489 32 2 669 2157 254437580 254436094 0.000000e+00 2560
3 TraesCS1B01G404600 chr1D 96.978 1489 43 2 669 2157 51869398 51870884 0.000000e+00 2499
4 TraesCS1B01G404600 chr1D 97.898 666 12 2 1 666 254450755 254450092 0.000000e+00 1151
5 TraesCS1B01G404600 chr5D 97.649 1489 33 2 670 2157 503294419 503292932 0.000000e+00 2555
6 TraesCS1B01G404600 chr5D 96.776 1489 30 4 669 2157 6174385 6175855 0.000000e+00 2468
7 TraesCS1B01G404600 chr5D 98.949 666 7 0 1 666 6259163 6259828 0.000000e+00 1192
8 TraesCS1B01G404600 chr5D 98.949 666 7 0 1 666 512406653 512405988 0.000000e+00 1192
9 TraesCS1B01G404600 chr5D 98.498 666 10 0 1 666 503307612 503306947 0.000000e+00 1175
10 TraesCS1B01G404600 chr5D 97.898 666 12 1 1 666 187963169 187963832 0.000000e+00 1151
11 TraesCS1B01G404600 chr4B 96.781 1491 44 4 669 2157 308677218 308678706 0.000000e+00 2484
12 TraesCS1B01G404600 chr4D 95.573 1491 59 7 669 2157 207065687 207067172 0.000000e+00 2381
13 TraesCS1B01G404600 chr4A 94.631 1490 57 9 669 2157 309487274 309488741 0.000000e+00 2287
14 TraesCS1B01G404600 chr4A 97.455 668 15 1 1 666 309452457 309453124 0.000000e+00 1138
15 TraesCS1B01G404600 chr4A 92.478 452 14 6 1661 2108 604111957 604112392 1.410000e-176 628
16 TraesCS1B01G404600 chrUn 98.904 1095 11 1 669 1763 381152613 381153706 0.000000e+00 1954
17 TraesCS1B01G404600 chr1A 98.951 667 5 2 1 666 554476201 554475536 0.000000e+00 1192
18 TraesCS1B01G404600 chr7B 98.348 666 11 0 1 666 137680602 137679937 0.000000e+00 1170
19 TraesCS1B01G404600 chr6B 98.198 666 12 0 1 666 18744319 18744984 0.000000e+00 1164
20 TraesCS1B01G404600 chr7D 98.974 585 4 1 669 1251 231597141 231596557 0.000000e+00 1046
21 TraesCS1B01G404600 chr3B 90.698 129 11 1 1987 2114 768527413 768527285 1.020000e-38 171


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G404600 chr1B 633708753 633710909 2156 True 3984 3984 100.000 1 2157 1 chr1B.!!$R1 2156
1 TraesCS1B01G404600 chr2D 638425566 638427051 1485 True 2608 2608 98.321 669 2157 1 chr2D.!!$R1 1488
2 TraesCS1B01G404600 chr1D 254436094 254437580 1486 True 2560 2560 97.717 669 2157 1 chr1D.!!$R1 1488
3 TraesCS1B01G404600 chr1D 51869398 51870884 1486 False 2499 2499 96.978 669 2157 1 chr1D.!!$F1 1488
4 TraesCS1B01G404600 chr1D 254450092 254450755 663 True 1151 1151 97.898 1 666 1 chr1D.!!$R2 665
5 TraesCS1B01G404600 chr5D 503292932 503294419 1487 True 2555 2555 97.649 670 2157 1 chr5D.!!$R1 1487
6 TraesCS1B01G404600 chr5D 6174385 6175855 1470 False 2468 2468 96.776 669 2157 1 chr5D.!!$F1 1488
7 TraesCS1B01G404600 chr5D 6259163 6259828 665 False 1192 1192 98.949 1 666 1 chr5D.!!$F2 665
8 TraesCS1B01G404600 chr5D 512405988 512406653 665 True 1192 1192 98.949 1 666 1 chr5D.!!$R3 665
9 TraesCS1B01G404600 chr5D 503306947 503307612 665 True 1175 1175 98.498 1 666 1 chr5D.!!$R2 665
10 TraesCS1B01G404600 chr5D 187963169 187963832 663 False 1151 1151 97.898 1 666 1 chr5D.!!$F3 665
11 TraesCS1B01G404600 chr4B 308677218 308678706 1488 False 2484 2484 96.781 669 2157 1 chr4B.!!$F1 1488
12 TraesCS1B01G404600 chr4D 207065687 207067172 1485 False 2381 2381 95.573 669 2157 1 chr4D.!!$F1 1488
13 TraesCS1B01G404600 chr4A 309487274 309488741 1467 False 2287 2287 94.631 669 2157 1 chr4A.!!$F2 1488
14 TraesCS1B01G404600 chr4A 309452457 309453124 667 False 1138 1138 97.455 1 666 1 chr4A.!!$F1 665
15 TraesCS1B01G404600 chrUn 381152613 381153706 1093 False 1954 1954 98.904 669 1763 1 chrUn.!!$F1 1094
16 TraesCS1B01G404600 chr1A 554475536 554476201 665 True 1192 1192 98.951 1 666 1 chr1A.!!$R1 665
17 TraesCS1B01G404600 chr7B 137679937 137680602 665 True 1170 1170 98.348 1 666 1 chr7B.!!$R1 665
18 TraesCS1B01G404600 chr6B 18744319 18744984 665 False 1164 1164 98.198 1 666 1 chr6B.!!$F1 665
19 TraesCS1B01G404600 chr7D 231596557 231597141 584 True 1046 1046 98.974 669 1251 1 chr7D.!!$R1 582

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
598 602 5.517411 CGTCTGCTAATACACGACCAATTAA 59.483 40.0 0.0 0.0 34.06 1.4 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1418 1438 1.675552 AACTGAGACAAACAACGGGG 58.324 50.0 0.0 0.0 0.0 5.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
311 313 6.742718 CGCCAGTATGAAAAGTTCTTAATGTG 59.257 38.462 9.19 4.42 39.69 3.21
598 602 5.517411 CGTCTGCTAATACACGACCAATTAA 59.483 40.000 0.00 0.00 34.06 1.40
666 670 6.075984 ACAGAAATACCTCGGATAGTACCAT 58.924 40.000 0.00 0.00 0.00 3.55
667 671 6.208994 ACAGAAATACCTCGGATAGTACCATC 59.791 42.308 0.00 0.00 0.00 3.51
935 939 8.698172 GAAATCAAAATTTCATGTTCGGTTTG 57.302 30.769 6.11 0.00 46.68 2.93
1394 1414 1.477295 CGAAAGGGACAGTCTACCTCC 59.523 57.143 0.00 0.00 32.29 4.30
1418 1438 4.814234 CCCTTCCCTTTAAAAACAGTTTGC 59.186 41.667 0.00 0.00 0.00 3.68
1702 1723 7.068593 TGGCAAGGAGATATTTTACCATTGAAG 59.931 37.037 0.00 0.00 0.00 3.02
1771 1792 2.291670 ACCTTCTATGTCTGGGTCGACT 60.292 50.000 16.46 0.00 35.00 4.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
311 313 1.599576 GGAGCCAGGGACTCAACTC 59.400 63.158 10.48 0.0 34.60 3.01
598 602 5.935206 ACGGAAAAACTTTTTGTCCAAACAT 59.065 32.000 4.17 0.0 34.73 2.71
666 670 7.099120 GGTTCTAGTAAACCAAAACTATCGGA 58.901 38.462 8.18 0.0 46.62 4.55
667 671 7.299787 GGTTCTAGTAAACCAAAACTATCGG 57.700 40.000 8.18 0.0 46.62 4.18
1394 1414 5.364778 CAAACTGTTTTTAAAGGGAAGGGG 58.635 41.667 2.41 0.0 0.00 4.79
1418 1438 1.675552 AACTGAGACAAACAACGGGG 58.324 50.000 0.00 0.0 0.00 5.73
1702 1723 4.785669 ATATATACCGTAGCGAGCGTAC 57.214 45.455 0.00 0.0 0.00 3.67


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.