Multiple sequence alignment - TraesCS1B01G384800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G384800 chr1B 100.000 2322 0 0 1 2322 618191027 618188706 0 4289
1 TraesCS1B01G384800 chr1B 98.752 2323 28 1 1 2322 615476936 615479258 0 4128
2 TraesCS1B01G384800 chr1B 97.977 2323 40 3 1 2322 122762319 122764635 0 4023
3 TraesCS1B01G384800 chr2B 98.794 2322 27 1 1 2322 90758840 90761160 0 4132
4 TraesCS1B01G384800 chr2B 98.268 2310 39 1 1 2310 631382564 631380256 0 4043
5 TraesCS1B01G384800 chr7B 98.665 2322 31 0 1 2322 678100720 678103041 0 4117
6 TraesCS1B01G384800 chr7B 98.363 2322 38 0 1 2322 134328684 134326363 0 4078
7 TraesCS1B01G384800 chr7B 97.454 2317 52 2 1 2310 664294587 664296903 0 3945
8 TraesCS1B01G384800 chr7B 97.399 2307 59 1 1 2307 680722560 680724865 0 3927
9 TraesCS1B01G384800 chr5B 97.749 2310 50 2 1 2310 415774296 415771989 0 3976


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G384800 chr1B 618188706 618191027 2321 True 4289 4289 100.000 1 2322 1 chr1B.!!$R1 2321
1 TraesCS1B01G384800 chr1B 615476936 615479258 2322 False 4128 4128 98.752 1 2322 1 chr1B.!!$F2 2321
2 TraesCS1B01G384800 chr1B 122762319 122764635 2316 False 4023 4023 97.977 1 2322 1 chr1B.!!$F1 2321
3 TraesCS1B01G384800 chr2B 90758840 90761160 2320 False 4132 4132 98.794 1 2322 1 chr2B.!!$F1 2321
4 TraesCS1B01G384800 chr2B 631380256 631382564 2308 True 4043 4043 98.268 1 2310 1 chr2B.!!$R1 2309
5 TraesCS1B01G384800 chr7B 678100720 678103041 2321 False 4117 4117 98.665 1 2322 1 chr7B.!!$F2 2321
6 TraesCS1B01G384800 chr7B 134326363 134328684 2321 True 4078 4078 98.363 1 2322 1 chr7B.!!$R1 2321
7 TraesCS1B01G384800 chr7B 664294587 664296903 2316 False 3945 3945 97.454 1 2310 1 chr7B.!!$F1 2309
8 TraesCS1B01G384800 chr7B 680722560 680724865 2305 False 3927 3927 97.399 1 2307 1 chr7B.!!$F3 2306
9 TraesCS1B01G384800 chr5B 415771989 415774296 2307 True 3976 3976 97.749 1 2310 1 chr5B.!!$R1 2309

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
809 817 0.184692 TGGTGTTTCCTGATGGCACA 59.815 50.0 0.0 0.0 39.32 4.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2217 2227 0.734889 GTTGATGAACCTCCATGGCG 59.265 55.0 6.96 0.0 40.22 5.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
545 553 4.092279 TGGAGGATATTGCGATGATCTCT 58.908 43.478 0.00 0.0 0.00 3.10
747 755 1.292223 GCTAGTCCGGCTGTTGTGA 59.708 57.895 0.00 0.0 0.00 3.58
809 817 0.184692 TGGTGTTTCCTGATGGCACA 59.815 50.000 0.00 0.0 39.32 4.57
1280 1288 9.841295 AAATATCAAATGCCTTGCTATCAATTT 57.159 25.926 0.00 0.0 34.76 1.82
1688 1697 1.064758 GGGTGGACATGTGGAATGCTA 60.065 52.381 1.15 0.0 0.00 3.49
1858 1867 1.136305 GCTGCTGATGGTGCATTCAAT 59.864 47.619 0.00 0.0 39.86 2.57
2217 2227 2.424246 ACACTAGCCGCTTTACTCTCTC 59.576 50.000 0.00 0.0 0.00 3.20
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
146 147 5.255397 TCATCAAGGCCGGGATATTTATT 57.745 39.130 2.18 0.0 0.00 1.40
287 295 5.892348 ACTGGAGGAACCTACAAAAATCAT 58.108 37.500 7.22 0.0 36.31 2.45
545 553 2.423898 GCCCTCGATCGGAAGACCA 61.424 63.158 16.41 0.0 46.97 4.02
747 755 1.490910 GTAAGCCCTGGCATACCTCTT 59.509 52.381 11.38 0.0 44.88 2.85
809 817 2.279069 CCACGAGGCTGTGTCTCCT 61.279 63.158 13.48 0.0 38.20 3.69
1498 1507 4.816385 CACCACACTTGTCTCAACATACTT 59.184 41.667 0.00 0.0 34.73 2.24
1590 1599 6.341316 GTCCTACAAAGCATGAGAAGTATCA 58.659 40.000 0.00 0.0 0.00 2.15
1688 1697 0.984230 TCAACTCGGGCATTCCTCTT 59.016 50.000 0.00 0.0 0.00 2.85
1858 1867 6.689561 TCCAATGGTCTCCCTAATAGAGTTA 58.310 40.000 0.00 0.0 32.93 2.24
2217 2227 0.734889 GTTGATGAACCTCCATGGCG 59.265 55.000 6.96 0.0 40.22 5.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.