Multiple sequence alignment - TraesCS1B01G383500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G383500 chr1B 100.000 2322 0 0 1 2322 615476936 615479257 0 4289
1 TraesCS1B01G383500 chr1B 98.751 2322 28 1 1 2322 618191027 618188707 0 4126
2 TraesCS1B01G383500 chr1B 98.192 2323 34 4 1 2322 122762319 122764634 0 4050
3 TraesCS1B01G383500 chr7B 99.009 2322 22 1 1 2322 678100720 678103040 0 4159
4 TraesCS1B01G383500 chr7B 98.493 2322 34 1 1 2322 134328684 134326364 0 4093
5 TraesCS1B01G383500 chr7B 97.627 2318 47 3 1 2311 664294587 664296903 0 3969
6 TraesCS1B01G383500 chr7B 97.530 2308 55 2 1 2308 680722560 680724865 0 3945
7 TraesCS1B01G383500 chr2B 98.837 2322 25 2 1 2322 90758840 90761159 0 4137
8 TraesCS1B01G383500 chr2B 98.226 2311 39 2 1 2311 631382564 631380256 0 4039
9 TraesCS1B01G383500 chr5B 97.966 2311 44 2 1 2311 415774296 415771989 0 4004


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G383500 chr1B 615476936 615479257 2321 False 4289 4289 100.000 1 2322 1 chr1B.!!$F2 2321
1 TraesCS1B01G383500 chr1B 618188707 618191027 2320 True 4126 4126 98.751 1 2322 1 chr1B.!!$R1 2321
2 TraesCS1B01G383500 chr1B 122762319 122764634 2315 False 4050 4050 98.192 1 2322 1 chr1B.!!$F1 2321
3 TraesCS1B01G383500 chr7B 678100720 678103040 2320 False 4159 4159 99.009 1 2322 1 chr7B.!!$F2 2321
4 TraesCS1B01G383500 chr7B 134326364 134328684 2320 True 4093 4093 98.493 1 2322 1 chr7B.!!$R1 2321
5 TraesCS1B01G383500 chr7B 664294587 664296903 2316 False 3969 3969 97.627 1 2311 1 chr7B.!!$F1 2310
6 TraesCS1B01G383500 chr7B 680722560 680724865 2305 False 3945 3945 97.530 1 2308 1 chr7B.!!$F3 2307
7 TraesCS1B01G383500 chr2B 90758840 90761159 2319 False 4137 4137 98.837 1 2322 1 chr2B.!!$F1 2321
8 TraesCS1B01G383500 chr2B 631380256 631382564 2308 True 4039 4039 98.226 1 2311 1 chr2B.!!$R1 2310
9 TraesCS1B01G383500 chr5B 415771989 415774296 2307 True 4004 4004 97.966 1 2311 1 chr5B.!!$R1 2310

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1012 1020 3.319405 CGGAGCATGTATGAGGAGTAAGT 59.681 47.826 0.0 0.0 0.0 2.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2021 2029 1.743394 GGCCAAGCACCACATTACTAC 59.257 52.381 0.0 0.0 0.0 2.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1012 1020 3.319405 CGGAGCATGTATGAGGAGTAAGT 59.681 47.826 0.0 0.0 0.00 2.24
1494 1502 1.228033 AGTACAACAACGCACCCCC 60.228 57.895 0.0 0.0 0.00 5.40
1588 1596 8.539674 GTGTAACCACTGAAAAATGAAATTGAC 58.460 33.333 0.0 0.0 36.07 3.18
1658 1666 7.533083 AGAATGTCATTAATTGGGAGGATCAT 58.467 34.615 0.0 0.0 36.25 2.45
2021 2029 5.426504 GGAGCTATGGAGATGTATCAATGG 58.573 45.833 0.0 0.0 0.00 3.16
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1012 1020 3.485463 ACCACCAAGACAAGATTTCGA 57.515 42.857 0.00 0.0 0.00 3.71
1384 1392 1.336755 ACGCCAAAGATGTTTGTCACC 59.663 47.619 13.69 0.0 41.44 4.02
1390 1398 0.317770 CGCACACGCCAAAGATGTTT 60.318 50.000 0.00 0.0 33.11 2.83
1494 1502 2.654749 TGTCTCAACATACTCTGGCG 57.345 50.000 0.00 0.0 0.00 5.69
1498 1506 4.345257 ACCACACTTGTCTCAACATACTCT 59.655 41.667 0.00 0.0 34.73 3.24
1588 1596 3.935203 ACAAAGCATGAGAAGTATCGGTG 59.065 43.478 0.00 0.0 0.00 4.94
1658 1666 3.523157 ACATGTCCACCCACATAAGATGA 59.477 43.478 0.00 0.0 35.10 2.92
2021 2029 1.743394 GGCCAAGCACCACATTACTAC 59.257 52.381 0.00 0.0 0.00 2.73


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.