Multiple sequence alignment - TraesCS1B01G376200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G376200 chr1B 100.000 2685 0 0 1 2685 607317825 607315141 0.000000e+00 4959.0
1 TraesCS1B01G376200 chr1B 99.106 2686 19 2 1 2685 607138689 607136008 0.000000e+00 4822.0
2 TraesCS1B01G376200 chr1B 92.979 1581 85 11 8 1578 608336686 608335122 0.000000e+00 2281.0
3 TraesCS1B01G376200 chr1B 89.189 1554 100 23 429 1947 610892629 610894149 0.000000e+00 1877.0
4 TraesCS1B01G376200 chr1B 87.331 1034 73 27 784 1787 608043033 608042028 0.000000e+00 1131.0
5 TraesCS1B01G376200 chr1B 92.810 765 51 2 1 761 608044018 608043254 0.000000e+00 1105.0
6 TraesCS1B01G376200 chr1B 83.643 807 87 31 822 1606 521860760 521861543 0.000000e+00 717.0
7 TraesCS1B01G376200 chr1B 88.256 562 50 15 828 1383 516971897 516971346 0.000000e+00 658.0
8 TraesCS1B01G376200 chr1B 91.489 188 15 1 1982 2169 610894651 610894837 9.540000e-65 257.0
9 TraesCS1B01G376200 chr1B 88.983 118 12 1 2295 2411 521863126 521863243 7.750000e-31 145.0
10 TraesCS1B01G376200 chr1B 79.459 185 19 7 2519 2685 608041443 608041260 2.180000e-21 113.0
11 TraesCS1B01G376200 chr1D 90.847 1180 59 18 794 1947 445367078 445365922 0.000000e+00 1535.0
12 TraesCS1B01G376200 chr1D 89.882 1018 64 17 483 1474 446475595 446476599 0.000000e+00 1273.0
13 TraesCS1B01G376200 chr1D 84.100 522 57 11 2170 2672 355753075 355753589 5.200000e-132 481.0
14 TraesCS1B01G376200 chr1D 83.368 475 35 10 2231 2685 445365695 445365245 1.500000e-107 399.0
15 TraesCS1B01G376200 chr1D 83.740 369 57 3 1 367 387422758 387422391 1.980000e-91 346.0
16 TraesCS1B01G376200 chr1D 87.892 223 17 1 1947 2169 355829385 355829597 1.230000e-63 254.0
17 TraesCS1B01G376200 chr1A 88.275 1177 47 25 791 1947 541343556 541344661 0.000000e+00 1325.0
18 TraesCS1B01G376200 chr1A 86.422 1171 89 39 794 1947 541461048 541459931 0.000000e+00 1218.0
19 TraesCS1B01G376200 chr1A 85.503 676 64 18 856 1522 62794691 62794041 0.000000e+00 675.0
20 TraesCS1B01G376200 chr1A 86.579 611 60 11 856 1455 490418109 490418708 0.000000e+00 654.0
21 TraesCS1B01G376200 chr1A 89.326 534 33 3 2170 2683 541459265 541458736 0.000000e+00 649.0
22 TraesCS1B01G376200 chr1A 85.905 525 47 8 2170 2672 456372570 456373089 3.930000e-148 534.0
23 TraesCS1B01G376200 chr1A 90.805 87 7 1 671 756 456653276 456653362 6.070000e-22 115.0
24 TraesCS1B01G376200 chr3D 84.276 1202 104 45 790 1947 114880995 114879835 0.000000e+00 1094.0
25 TraesCS1B01G376200 chr3A 81.057 776 88 19 1947 2685 111102862 111102109 5.020000e-157 564.0
26 TraesCS1B01G376200 chr7D 84.054 370 55 4 1 367 230998414 230998046 1.180000e-93 353.0
27 TraesCS1B01G376200 chr7D 84.066 364 56 2 3 364 3103700 3104063 1.530000e-92 350.0
28 TraesCS1B01G376200 chr7D 83.924 367 57 2 3 367 3160068 3159702 1.530000e-92 350.0
29 TraesCS1B01G376200 chr7D 83.245 376 59 4 1 373 226461373 226460999 2.560000e-90 342.0
30 TraesCS1B01G376200 chr2D 83.469 369 56 5 1 367 101874277 101874642 3.310000e-89 339.0
31 TraesCS1B01G376200 chr5A 92.593 54 4 0 2329 2382 380562233 380562286 7.970000e-11 78.7
32 TraesCS1B01G376200 chr6B 95.556 45 2 0 2329 2373 63921989 63922033 3.710000e-09 73.1
33 TraesCS1B01G376200 chr7B 87.037 54 3 4 1701 1751 85298011 85298063 1.040000e-04 58.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G376200 chr1B 607315141 607317825 2684 True 4959.0 4959 100.000000 1 2685 1 chr1B.!!$R3 2684
1 TraesCS1B01G376200 chr1B 607136008 607138689 2681 True 4822.0 4822 99.106000 1 2685 1 chr1B.!!$R2 2684
2 TraesCS1B01G376200 chr1B 608335122 608336686 1564 True 2281.0 2281 92.979000 8 1578 1 chr1B.!!$R4 1570
3 TraesCS1B01G376200 chr1B 610892629 610894837 2208 False 1067.0 1877 90.339000 429 2169 2 chr1B.!!$F2 1740
4 TraesCS1B01G376200 chr1B 608041260 608044018 2758 True 783.0 1131 86.533333 1 2685 3 chr1B.!!$R5 2684
5 TraesCS1B01G376200 chr1B 516971346 516971897 551 True 658.0 658 88.256000 828 1383 1 chr1B.!!$R1 555
6 TraesCS1B01G376200 chr1B 521860760 521863243 2483 False 431.0 717 86.313000 822 2411 2 chr1B.!!$F1 1589
7 TraesCS1B01G376200 chr1D 446475595 446476599 1004 False 1273.0 1273 89.882000 483 1474 1 chr1D.!!$F3 991
8 TraesCS1B01G376200 chr1D 445365245 445367078 1833 True 967.0 1535 87.107500 794 2685 2 chr1D.!!$R2 1891
9 TraesCS1B01G376200 chr1D 355753075 355753589 514 False 481.0 481 84.100000 2170 2672 1 chr1D.!!$F1 502
10 TraesCS1B01G376200 chr1A 541343556 541344661 1105 False 1325.0 1325 88.275000 791 1947 1 chr1A.!!$F4 1156
11 TraesCS1B01G376200 chr1A 541458736 541461048 2312 True 933.5 1218 87.874000 794 2683 2 chr1A.!!$R2 1889
12 TraesCS1B01G376200 chr1A 62794041 62794691 650 True 675.0 675 85.503000 856 1522 1 chr1A.!!$R1 666
13 TraesCS1B01G376200 chr1A 490418109 490418708 599 False 654.0 654 86.579000 856 1455 1 chr1A.!!$F3 599
14 TraesCS1B01G376200 chr1A 456372570 456373089 519 False 534.0 534 85.905000 2170 2672 1 chr1A.!!$F1 502
15 TraesCS1B01G376200 chr3D 114879835 114880995 1160 True 1094.0 1094 84.276000 790 1947 1 chr3D.!!$R1 1157
16 TraesCS1B01G376200 chr3A 111102109 111102862 753 True 564.0 564 81.057000 1947 2685 1 chr3A.!!$R1 738

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
144 145 1.134907 GCCGAAGTTCCGTCTAATCCA 60.135 52.381 0.0 0.0 0.0 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2526 4321 0.033366 ATGCACACGTCTGTAGCACA 59.967 50.0 0.0 0.0 37.3 4.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
144 145 1.134907 GCCGAAGTTCCGTCTAATCCA 60.135 52.381 0.00 0.0 0.00 3.41
152 153 1.332686 TCCGTCTAATCCATCACGACG 59.667 52.381 0.00 0.0 44.89 5.12
539 540 9.665264 GGTACTCTTCATTTTTGTCTTTTACAG 57.335 33.333 0.00 0.0 39.87 2.74
792 999 2.435437 GGCATGTTTATGGAAATGGCCT 59.565 45.455 3.32 0.0 36.09 5.19
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
15 16 5.530171 CAGATCGATTCAAGGATTCAATGGT 59.470 40.000 0.00 0.0 0.00 3.55
144 145 1.401148 CCTCAAGTCGTTCGTCGTGAT 60.401 52.381 8.07 0.0 40.80 3.06
152 153 1.202313 CCGATCCTCCTCAAGTCGTTC 60.202 57.143 0.00 0.0 0.00 3.95
539 540 9.840427 AGTGTTACTATCAATACAAATTGCAAC 57.160 29.630 0.00 0.0 41.96 4.17
792 999 0.530288 GGCGGCAGCTCCAAATTTTA 59.470 50.000 9.17 0.0 44.37 1.52
2526 4321 0.033366 ATGCACACGTCTGTAGCACA 59.967 50.000 0.00 0.0 37.30 4.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.