Multiple sequence alignment - TraesCS1B01G370100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G370100 chr1B 100.000 2315 0 0 1 2315 599836319 599838633 0.000000e+00 4276.0
1 TraesCS1B01G370100 chr1B 98.197 2330 23 10 1 2315 599635604 599637929 0.000000e+00 4052.0
2 TraesCS1B01G370100 chr1B 97.982 2329 29 6 1 2315 599706812 599709136 0.000000e+00 4024.0
3 TraesCS1B01G370100 chr1B 98.826 1874 18 3 445 2315 599925578 599927450 0.000000e+00 3336.0
4 TraesCS1B01G370100 chr1B 98.667 1876 20 3 445 2315 599982766 599984641 0.000000e+00 3321.0
5 TraesCS1B01G370100 chr1B 96.711 1824 45 4 1 1814 599764774 599766592 0.000000e+00 3022.0
6 TraesCS1B01G370100 chr1B 98.552 1658 17 5 663 2315 599577667 599579322 0.000000e+00 2922.0
7 TraesCS1B01G370100 chr1B 96.629 445 6 1 1 436 599982173 599982617 0.000000e+00 730.0
8 TraesCS1B01G370100 chr1B 95.022 462 12 5 1861 2314 599766789 599767247 0.000000e+00 715.0
9 TraesCS1B01G370100 chr1B 95.694 418 8 2 1 409 599924858 599925274 0.000000e+00 664.0
10 TraesCS1B01G370100 chr1B 93.781 402 14 4 1 393 599577274 599577673 5.510000e-166 593.0
11 TraesCS1B01G370100 chr1D 92.597 1810 86 20 40 1814 441739564 441741360 0.000000e+00 2556.0
12 TraesCS1B01G370100 chr1D 86.953 1418 115 34 962 2315 441644236 441645647 0.000000e+00 1530.0
13 TraesCS1B01G370100 chr1D 93.029 789 25 13 1 783 441631898 441632662 0.000000e+00 1125.0
14 TraesCS1B01G370100 chr1D 90.661 514 37 7 1813 2315 441741389 441741902 0.000000e+00 673.0
15 TraesCS1B01G370100 chr1D 89.825 285 19 4 1 276 441577848 441578131 7.870000e-95 357.0
16 TraesCS1B01G370100 chr1D 95.775 142 6 0 828 969 441632663 441632804 1.790000e-56 230.0
17 TraesCS1B01G370100 chr1D 78.846 104 15 6 1665 1764 445047933 445048033 1.920000e-06 63.9
18 TraesCS1B01G370100 chr1A 86.786 840 79 18 996 1820 536629864 536629042 0.000000e+00 907.0
19 TraesCS1B01G370100 chr1A 90.295 237 21 1 760 996 536630127 536629893 2.230000e-80 309.0
20 TraesCS1B01G370100 chr2B 81.618 136 20 5 255 388 793021566 793021698 8.750000e-20 108.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G370100 chr1B 599836319 599838633 2314 False 4276.0 4276 100.0000 1 2315 1 chr1B.!!$F3 2314
1 TraesCS1B01G370100 chr1B 599635604 599637929 2325 False 4052.0 4052 98.1970 1 2315 1 chr1B.!!$F1 2314
2 TraesCS1B01G370100 chr1B 599706812 599709136 2324 False 4024.0 4024 97.9820 1 2315 1 chr1B.!!$F2 2314
3 TraesCS1B01G370100 chr1B 599982173 599984641 2468 False 2025.5 3321 97.6480 1 2315 2 chr1B.!!$F7 2314
4 TraesCS1B01G370100 chr1B 599924858 599927450 2592 False 2000.0 3336 97.2600 1 2315 2 chr1B.!!$F6 2314
5 TraesCS1B01G370100 chr1B 599764774 599767247 2473 False 1868.5 3022 95.8665 1 2314 2 chr1B.!!$F5 2313
6 TraesCS1B01G370100 chr1B 599577274 599579322 2048 False 1757.5 2922 96.1665 1 2315 2 chr1B.!!$F4 2314
7 TraesCS1B01G370100 chr1D 441739564 441741902 2338 False 1614.5 2556 91.6290 40 2315 2 chr1D.!!$F5 2275
8 TraesCS1B01G370100 chr1D 441644236 441645647 1411 False 1530.0 1530 86.9530 962 2315 1 chr1D.!!$F2 1353
9 TraesCS1B01G370100 chr1D 441631898 441632804 906 False 677.5 1125 94.4020 1 969 2 chr1D.!!$F4 968
10 TraesCS1B01G370100 chr1A 536629042 536630127 1085 True 608.0 907 88.5405 760 1820 2 chr1A.!!$R1 1060

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
39 40 8.978564 ATACATGTTTTGCACGATTTTAATCA 57.021 26.923 2.3 0.0 35.11 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1734 2071 1.614711 GCCCATCCAAGTCATCCCA 59.385 57.895 0.0 0.0 0.0 4.37 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
39 40 8.978564 ATACATGTTTTGCACGATTTTAATCA 57.021 26.923 2.30 0.00 35.11 2.57
1333 1651 6.743773 GCACTAGGCAGAATTGATAAGAGGAT 60.744 42.308 0.00 0.00 43.97 3.24
1734 2071 2.815308 CTCTTGGCTATCCGGCGT 59.185 61.111 6.01 0.00 42.02 5.68
1842 2211 2.548178 GTCACGGAGACACTCGGTA 58.452 57.895 10.61 0.45 46.77 4.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
39 40 6.228258 AGCTCACATTGAAAAATCTTTGCAT 58.772 32.000 0.00 0.00 0.00 3.96
805 1088 7.995289 TGTATAGTAGCAAACCCATGAATTTG 58.005 34.615 14.11 14.11 38.57 2.32
954 1240 1.961180 GATGCCACGAGGTAGCCTGT 61.961 60.000 0.00 0.00 37.19 4.00
1170 1488 3.305709 CTTGAACAGGAAGACGCCA 57.694 52.632 0.00 0.00 0.00 5.69
1734 2071 1.614711 GCCCATCCAAGTCATCCCA 59.385 57.895 0.00 0.00 0.00 4.37
1842 2211 6.564557 AAAATATGCCAGGGAACAAATGAT 57.435 33.333 0.00 0.00 0.00 2.45


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.