Multiple sequence alignment - TraesCS1B01G369800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G369800 chr1B 100.000 2670 0 0 1 2670 599762821 599765490 0.000000e+00 4931.0
1 TraesCS1B01G369800 chr1B 98.963 2508 24 2 164 2670 599633814 599636320 0.000000e+00 4486.0
2 TraesCS1B01G369800 chr1B 98.923 2508 24 2 164 2670 599705023 599707528 0.000000e+00 4479.0
3 TraesCS1B01G369800 chr1B 98.567 2512 21 4 164 2670 599834529 599837030 0.000000e+00 4425.0
4 TraesCS1B01G369800 chr1B 98.792 2236 25 2 164 2398 599980383 599982617 0.000000e+00 3978.0
5 TraesCS1B01G369800 chr1B 98.506 2209 30 3 164 2371 599923068 599925274 0.000000e+00 3893.0
6 TraesCS1B01G369800 chr1B 96.673 2194 64 9 164 2355 599575487 599577673 0.000000e+00 3639.0
7 TraesCS1B01G369800 chr1B 97.761 268 2 1 2407 2670 599925578 599925845 2.420000e-125 459.0
8 TraesCS1B01G369800 chr1B 97.761 268 2 1 2407 2670 599982766 599983033 2.420000e-125 459.0
9 TraesCS1B01G369800 chr1B 99.408 169 1 0 1 169 599980089 599980257 9.280000e-80 307.0
10 TraesCS1B01G369800 chr1B 98.817 169 2 0 1 169 599633520 599633688 4.320000e-78 302.0
11 TraesCS1B01G369800 chr1B 98.817 169 2 0 1 169 599834235 599834403 4.320000e-78 302.0
12 TraesCS1B01G369800 chr1B 98.817 169 2 0 1 169 599922774 599922942 4.320000e-78 302.0
13 TraesCS1B01G369800 chr1B 98.795 166 2 0 1 166 599704729 599704894 2.010000e-76 296.0
14 TraesCS1B01G369800 chr1B 97.041 169 5 0 1 169 599575193 599575361 4.350000e-73 285.0
15 TraesCS1B01G369800 chr1B 98.000 50 0 1 2621 2670 599577667 599577715 4.740000e-13 86.1
16 TraesCS1B01G369800 chr1D 97.396 1805 42 4 164 1967 441737777 441739577 0.000000e+00 3068.0
17 TraesCS1B01G369800 chr1D 91.591 2081 159 13 164 2238 441576061 441578131 0.000000e+00 2859.0
18 TraesCS1B01G369800 chr1D 95.134 1829 41 14 852 2670 441630801 441632591 0.000000e+00 2841.0
19 TraesCS1B01G369800 chr1D 96.318 679 20 2 1996 2670 441739567 441740244 0.000000e+00 1110.0
20 TraesCS1B01G369800 chr1D 97.152 632 17 1 164 795 441630173 441630803 0.000000e+00 1066.0
21 TraesCS1B01G369800 chr1D 96.450 169 6 0 1 169 441737482 441737650 2.020000e-71 279.0
22 TraesCS1B01G369800 chr1D 94.083 169 10 0 1 169 441629878 441630046 9.480000e-65 257.0
23 TraesCS1B01G369800 chr2B 79.096 177 30 7 2176 2350 793021527 793021698 6.040000e-22 115.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G369800 chr1B 599762821 599765490 2669 False 4931.000000 4931 100.000000 1 2670 1 chr1B.!!$F1 2669
1 TraesCS1B01G369800 chr1B 599633520 599636320 2800 False 2394.000000 4486 98.890000 1 2670 2 chr1B.!!$F3 2669
2 TraesCS1B01G369800 chr1B 599704729 599707528 2799 False 2387.500000 4479 98.859000 1 2670 2 chr1B.!!$F4 2669
3 TraesCS1B01G369800 chr1B 599834235 599837030 2795 False 2363.500000 4425 98.692000 1 2670 2 chr1B.!!$F5 2669
4 TraesCS1B01G369800 chr1B 599980089 599983033 2944 False 1581.333333 3978 98.653667 1 2670 3 chr1B.!!$F7 2669
5 TraesCS1B01G369800 chr1B 599922774 599925845 3071 False 1551.333333 3893 98.361333 1 2670 3 chr1B.!!$F6 2669
6 TraesCS1B01G369800 chr1B 599575193 599577715 2522 False 1336.700000 3639 97.238000 1 2670 3 chr1B.!!$F2 2669
7 TraesCS1B01G369800 chr1D 441576061 441578131 2070 False 2859.000000 2859 91.591000 164 2238 1 chr1D.!!$F1 2074
8 TraesCS1B01G369800 chr1D 441737482 441740244 2762 False 1485.666667 3068 96.721333 1 2670 3 chr1D.!!$F3 2669
9 TraesCS1B01G369800 chr1D 441629878 441632591 2713 False 1388.000000 2841 95.456333 1 2670 3 chr1D.!!$F2 2669

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
107 108 0.179020 ACTTGGTAGCAGCTGCACAA 60.179 50.000 38.24 32.82 45.16 3.33 F
747 886 1.208293 GTGAGACCAATCAGAGGGGAC 59.792 57.143 0.00 0.00 0.00 4.46 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1021 1220 1.083489 GTTCCGATGCGTGGAAATCA 58.917 50.000 10.28 0.0 46.53 2.57 R
2521 3000 3.197983 AGATTTGCTAGTAAAGGTCGGCT 59.802 43.478 11.72 0.0 0.00 5.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
107 108 0.179020 ACTTGGTAGCAGCTGCACAA 60.179 50.000 38.24 32.82 45.16 3.33
444 582 3.513909 TTGATTGCCCTATCTCCCATG 57.486 47.619 0.00 0.00 0.00 3.66
747 886 1.208293 GTGAGACCAATCAGAGGGGAC 59.792 57.143 0.00 0.00 0.00 4.46
825 964 5.764686 CCGTCATTGATCATAAAATCCTCCA 59.235 40.000 0.00 0.00 0.00 3.86
916 1114 3.562141 CACAGGGTTGTTTGTTCGTATCA 59.438 43.478 0.00 0.00 34.62 2.15
1021 1220 3.606687 CTTTATAAGCACCTCACCCGTT 58.393 45.455 0.00 0.00 0.00 4.44
1431 1630 8.923270 TCATTGTTGGATCTATGTAGTATGTCA 58.077 33.333 0.00 0.00 0.00 3.58
2031 2233 4.693283 TGTGAGCTATTTTGATCGTAGGG 58.307 43.478 0.00 0.00 0.00 3.53
2521 3000 5.061721 TGTCTGATGTCTACTATAGCCCA 57.938 43.478 0.00 0.00 0.00 5.36
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
444 582 3.824443 ACCCACCACTAATGCAAAAGTAC 59.176 43.478 4.18 0.00 0.00 2.73
747 886 1.465777 GTTCGGATTTTGTACACCCCG 59.534 52.381 14.57 14.57 38.41 5.73
825 964 4.898320 TGGCGCATCAACTGAGATTATAT 58.102 39.130 10.83 0.00 0.00 0.86
916 1114 6.038985 CGAATCAACTCATATCTGGCGATAT 58.961 40.000 6.17 6.17 42.23 1.63
1021 1220 1.083489 GTTCCGATGCGTGGAAATCA 58.917 50.000 10.28 0.00 46.53 2.57
1431 1630 1.665679 CCTAGTGCGCAAACATCGATT 59.334 47.619 14.00 0.00 0.00 3.34
2521 3000 3.197983 AGATTTGCTAGTAAAGGTCGGCT 59.802 43.478 11.72 0.00 0.00 5.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.