Multiple sequence alignment - TraesCS1B01G369700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G369700 chr1B 100.000 2369 0 0 1 2369 599635555 599637923 0.000000e+00 4375.0
1 TraesCS1B01G369700 chr1B 99.071 2369 21 1 1 2369 599706763 599709130 0.000000e+00 4252.0
2 TraesCS1B01G369700 chr1B 98.188 2373 24 10 1 2369 599836270 599838627 0.000000e+00 4126.0
3 TraesCS1B01G369700 chr1B 98.717 1871 19 2 503 2369 599982766 599984635 0.000000e+00 3317.0
4 TraesCS1B01G369700 chr1B 98.664 1871 17 5 503 2369 599925578 599927444 0.000000e+00 3310.0
5 TraesCS1B01G369700 chr1B 97.860 1869 39 1 1 1869 599764725 599766592 0.000000e+00 3229.0
6 TraesCS1B01G369700 chr1B 99.093 1653 12 3 717 2369 599577667 599579316 0.000000e+00 2966.0
7 TraesCS1B01G369700 chr1B 98.785 494 6 0 1 494 599982124 599982617 0.000000e+00 880.0
8 TraesCS1B01G369700 chr1B 98.287 467 7 1 1 467 599924809 599925274 0.000000e+00 817.0
9 TraesCS1B01G369700 chr1B 95.133 452 18 4 1 451 599577225 599577673 0.000000e+00 710.0
10 TraesCS1B01G369700 chr1B 93.846 455 19 4 1921 2369 599766791 599767242 0.000000e+00 676.0
11 TraesCS1B01G369700 chr1B 96.226 53 0 1 1868 1918 599766621 599766673 4.200000e-13 86.1
12 TraesCS1B01G369700 chr1D 93.193 1807 81 20 92 1869 441739567 441741360 0.000000e+00 2617.0
13 TraesCS1B01G369700 chr1D 87.341 1414 111 33 1016 2369 441644236 441645641 0.000000e+00 1557.0
14 TraesCS1B01G369700 chr1D 92.908 846 19 8 1 837 441631849 441632662 0.000000e+00 1192.0
15 TraesCS1B01G369700 chr1D 90.000 510 41 6 1868 2369 441741389 441741896 0.000000e+00 651.0
16 TraesCS1B01G369700 chr1D 90.120 334 32 1 1 334 441577799 441578131 1.300000e-117 433.0
17 TraesCS1B01G369700 chr1D 95.775 142 6 0 882 1023 441632663 441632804 1.830000e-56 230.0
18 TraesCS1B01G369700 chr1D 95.238 63 2 1 1 63 441739516 441739577 5.390000e-17 99.0
19 TraesCS1B01G369700 chr1D 78.641 103 17 4 1720 1819 445047933 445048033 1.970000e-06 63.9
20 TraesCS1B01G369700 chr1A 87.143 840 77 18 1050 1875 536629864 536629042 0.000000e+00 924.0
21 TraesCS1B01G369700 chr1A 90.717 237 20 1 814 1050 536630127 536629893 4.920000e-82 315.0
22 TraesCS1B01G369700 chr2B 79.096 177 30 7 272 446 793021527 793021698 5.350000e-22 115.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G369700 chr1B 599635555 599637923 2368 False 4375.000000 4375 100.000000 1 2369 1 chr1B.!!$F1 2368
1 TraesCS1B01G369700 chr1B 599706763 599709130 2367 False 4252.000000 4252 99.071000 1 2369 1 chr1B.!!$F2 2368
2 TraesCS1B01G369700 chr1B 599836270 599838627 2357 False 4126.000000 4126 98.188000 1 2369 1 chr1B.!!$F3 2368
3 TraesCS1B01G369700 chr1B 599982124 599984635 2511 False 2098.500000 3317 98.751000 1 2369 2 chr1B.!!$F7 2368
4 TraesCS1B01G369700 chr1B 599924809 599927444 2635 False 2063.500000 3310 98.475500 1 2369 2 chr1B.!!$F6 2368
5 TraesCS1B01G369700 chr1B 599577225 599579316 2091 False 1838.000000 2966 97.113000 1 2369 2 chr1B.!!$F4 2368
6 TraesCS1B01G369700 chr1B 599764725 599767242 2517 False 1330.366667 3229 95.977333 1 2369 3 chr1B.!!$F5 2368
7 TraesCS1B01G369700 chr1D 441644236 441645641 1405 False 1557.000000 1557 87.341000 1016 2369 1 chr1D.!!$F2 1353
8 TraesCS1B01G369700 chr1D 441739516 441741896 2380 False 1122.333333 2617 92.810333 1 2369 3 chr1D.!!$F5 2368
9 TraesCS1B01G369700 chr1D 441631849 441632804 955 False 711.000000 1192 94.341500 1 1023 2 chr1D.!!$F4 1022
10 TraesCS1B01G369700 chr1A 536629042 536630127 1085 True 619.500000 924 88.930000 814 1875 2 chr1A.!!$R1 1061

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
850 1404 4.753662 CTGCATGCAGGCCCCTGT 62.754 66.667 35.39 0.0 45.24 4.0 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1926 2685 2.608506 CCAACATCCACTGTACGAACGA 60.609 50.0 0.14 0.0 36.98 3.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
850 1404 4.753662 CTGCATGCAGGCCCCTGT 62.754 66.667 35.39 0.0 45.24 4.00
993 1548 5.278266 CGGTTGTTAGGAAGCAAATCAAAGA 60.278 40.000 0.00 0.0 0.00 2.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
850 1404 1.570803 CCATGAATTTCCCTGGCCAA 58.429 50.000 7.01 0.0 0.00 4.52
993 1548 9.794719 GAGGTAGCCTGGATTTATAAAAGTTAT 57.205 33.333 1.21 0.0 31.76 1.89
1926 2685 2.608506 CCAACATCCACTGTACGAACGA 60.609 50.000 0.14 0.0 36.98 3.85
2269 3045 3.386486 CTCAGTTACACAGGTTTGCGTA 58.614 45.455 0.00 0.0 0.00 4.42


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.