Multiple sequence alignment - TraesCS1B01G369600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G369600 chr1B 100.000 2321 0 0 1 2321 599633756 599636076 0.000000e+00 4287
1 TraesCS1B01G369600 chr1B 99.268 2321 16 1 1 2321 599704965 599707284 0.000000e+00 4191
2 TraesCS1B01G369600 chr1B 98.794 2321 19 1 1 2321 599834471 599836782 0.000000e+00 4122
3 TraesCS1B01G369600 chr1B 98.953 2293 24 0 1 2293 599980325 599982617 0.000000e+00 4102
4 TraesCS1B01G369600 chr1B 98.896 2264 23 2 59 2321 599762984 599765246 0.000000e+00 4041
5 TraesCS1B01G369600 chr1B 98.676 2266 29 1 1 2266 599923010 599925274 0.000000e+00 4017
6 TraesCS1B01G369600 chr1B 96.890 2251 63 7 1 2250 599575429 599577673 0.000000e+00 3762
7 TraesCS1B01G369600 chr1D 97.424 1863 43 4 1 1862 441737719 441739577 0.000000e+00 3169
8 TraesCS1B01G369600 chr1D 91.581 2138 166 11 1 2133 441576003 441578131 0.000000e+00 2939
9 TraesCS1B01G369600 chr1D 95.696 1580 39 12 747 2321 441630801 441632356 0.000000e+00 2514
10 TraesCS1B01G369600 chr1D 97.536 690 16 1 1 690 441630115 441630803 0.000000e+00 1179
11 TraesCS1B01G369600 chr1D 96.520 431 14 1 1891 2321 441739567 441739996 0.000000e+00 712
12 TraesCS1B01G369600 chr2B 79.096 177 30 7 2071 2245 793021527 793021698 5.240000e-22 115


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G369600 chr1B 599633756 599636076 2320 False 4287.0 4287 100.000 1 2321 1 chr1B.!!$F2 2320
1 TraesCS1B01G369600 chr1B 599704965 599707284 2319 False 4191.0 4191 99.268 1 2321 1 chr1B.!!$F3 2320
2 TraesCS1B01G369600 chr1B 599834471 599836782 2311 False 4122.0 4122 98.794 1 2321 1 chr1B.!!$F5 2320
3 TraesCS1B01G369600 chr1B 599980325 599982617 2292 False 4102.0 4102 98.953 1 2293 1 chr1B.!!$F7 2292
4 TraesCS1B01G369600 chr1B 599762984 599765246 2262 False 4041.0 4041 98.896 59 2321 1 chr1B.!!$F4 2262
5 TraesCS1B01G369600 chr1B 599923010 599925274 2264 False 4017.0 4017 98.676 1 2266 1 chr1B.!!$F6 2265
6 TraesCS1B01G369600 chr1B 599575429 599577673 2244 False 3762.0 3762 96.890 1 2250 1 chr1B.!!$F1 2249
7 TraesCS1B01G369600 chr1D 441576003 441578131 2128 False 2939.0 2939 91.581 1 2133 1 chr1D.!!$F1 2132
8 TraesCS1B01G369600 chr1D 441737719 441739996 2277 False 1940.5 3169 96.972 1 2321 2 chr1D.!!$F3 2320
9 TraesCS1B01G369600 chr1D 441630115 441632356 2241 False 1846.5 2514 96.616 1 2321 2 chr1D.!!$F2 2320

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
779 786 1.492176 GTCATGATCCTCCACACCCAT 59.508 52.381 0.0 0.0 0.0 4.0 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1766 1775 6.981559 GGTGGAACAAATACAAAAGCTGTTTA 59.018 34.615 0.0 0.0 44.16 2.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
299 304 7.114754 TGAATTGGAGAGATTTGTCTATGCTT 58.885 34.615 0.00 0.0 0.00 3.91
779 786 1.492176 GTCATGATCCTCCACACCCAT 59.508 52.381 0.00 0.0 0.00 4.00
1098 1105 1.615424 GGGCCAGGAGAAGGTGGTA 60.615 63.158 4.39 0.0 36.10 3.25
1400 1407 6.881065 TCTCTTGCAGAATTTGTATTGCTAGT 59.119 34.615 6.65 0.0 39.37 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
325 330 4.141482 GCAAAAGTATATGGGAGACAGGGA 60.141 45.833 0.00 0.0 0.00 4.20
1098 1105 1.003580 GTCATCCTCATGGTGTGGTGT 59.996 52.381 0.00 0.0 33.07 4.16
1400 1407 8.846211 ACGTCAGAAATTTCCTTGAAATAAGAA 58.154 29.630 14.61 0.0 40.77 2.52
1766 1775 6.981559 GGTGGAACAAATACAAAAGCTGTTTA 59.018 34.615 0.00 0.0 44.16 2.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.